ZNF197 (NM_001024855) Human Untagged Clone
CAT#: SC302307
ZNF197 (untagged)-Human zinc finger protein 197 (ZNF197), transcript variant 2
"NM_001024855" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ZNF197 |
Synonyms | D3S1363E; P18; VHLaK; ZKSCAN9; ZNF20; ZNF166; ZSCAN41 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001024855, the custom clone sequence may differ by one or more nucleotides
ATGACAAGAGAAAATGTAGCCCACAATGCTCTGAGACAAGAGGGCCTTGTGAAGGGGAAGGATGATACCT GGAAATGGGGAACCAGCTTCCAAGGAAGTAGCTCCTCTGTTTGGGAGACCTCCCACCTACACTTTAGACA ATTACGTTACCATGAGACATCTGGACCCCAGGAAGCCCTGAGCCGGCTCAGGGAACTCTGTCGCCGGTGG CTGAGACCAGAAGCACGCACCAAGGCACAGATCCTGGAGCTGCTGGTGCTGGAGCAGTTTCTGAGCATCC TGCCTGGGGAGATTCGGACCTGGGTACAGCTCCATCACCCTGGAAGTGGCGAGGAGGCTGTGGCCCTGGT AGAGGAGCTGCAGAAAGACCTTGATGGACCAGCAATACAAGTTCCAGTCCTTGTCAAGGATCAGGACACT CTCCAGAAGGTGGTGAGTGCCCCAGGAACAACACTTCCTCCTGTACTTCCTGGCAGCCACATAGCAGCTG AAATTTGCCCGCATCCTCCTACTGACCTAGTGGCATTCAACCTCCAGGATCCTCAGCATGATTCTCCTGC CCCTGAAGCTTCTGCCCTTTCCCAGGAAGAGAACCCAAGAAATCAATTAATGGCACTTATGCTCCTAACA GCCCAGCCCCAGGAGTTGGTGATGTTCGAGGAGGTGTCAGTATGCTTCACTTCAGAGGAATGGGCATGTC TGGGCCCAATCCAGAGGGCCTTGTACTGGGATGTGATGCTGGAGAATTATGGAAATGTGACCTCCCTAGG TTACAGGAAATACAGGAGGCAGAGGAACAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024855 |
ORF Size | 804 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001024855.2, NP_001020026.1 |
RefSeq Size | 2969 |
RefSeq ORF | 804 |
Locus ID | 10168 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein contains 20 tandemly arrayed C2H2-type zinc fingers, a Kruppel-associated box (KRAB) domain, and a SCAN box. This transcript turns over rapidly and contains 3' UTR AUUUA motifs, which are often a hallmark of rapid turnover. It is overexpressed in some thyroid papillary carcinomas. This gene is located in a cluster of zinc finger genes at 3p21. Naturally-occurring readthrough transcription is observed between this gene and the upstream zinc finger protein 660 gene and is represented by GeneID:110354863. [provided by RefSeq, May 2017] Transcript Variant: Variants 2 and 4 encode the same isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216051 | ZNF197 (Myc-DDK-tagged)-Human zinc finger protein 197 (ZNF197), transcript variant 2 |
USD 420.00 |
|
RG216051 | ZNF197 (GFP-tagged) - Human zinc finger protein 197 (ZNF197), transcript variant 2 |
USD 460.00 |
|
RC216051L3 | Lenti ORF clone of Human zinc finger protein 197 (ZNF197), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC216051L4 | Lenti ORF clone of Human zinc finger protein 197 (ZNF197), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review