AP2M1 (NM_001025205) Human Untagged Clone

CAT#: SC302369

AP2M1 (untagged)-Human adaptor-related protein complex 2, mu 1 subunit (AP2M1), transcript variant 2


  "NM_001025205" in other vectors (6)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "AP2M1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol AP2M1
Synonyms AP50; CLAPM1; MRD60; mu2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001025205, the custom clone sequence may differ by one or more nucleotides


ATGATTGGAGGCTTATTCATCTATAATCACAAGGGGGAGGTGCTCATCTCCCGAGTCTACCGAGATGACA
TCGGGAGGAACGCAGTGGATGCCTTTCGGGTCAATGTTATCCATGCCCGGCAGCAGGTGCGCAGCCCCGT
CACCAACATTGCTCGCACCAGCTTCTTCCACGTTAAGCGGTCCAACATTTGGCTGGCAGCAGTCACCAAG
CAGAATGTCAACGCTGCCATGGTCTTCGAATTCCTCTATAAGATGTGTGACGTGATGGCTGCCTACTTTG
GCAAGATCAGCGAGGAAAACATCAAGAACAATTTTGTGCTCATATATGAGCTGCTGGATGAGATTCTAGA
CTTTGGCTACCCACAGAATTCCGAGACAGGCGCGCTGAAAACCTTCATCACGCAGCAGGGCATCAAGAGT
CAGACAAAAGAAGAGCAGTCACAGATCACCAGCCAGGTAACTGGGCAGATTGGCTGGCGGCGAGAGGGTA
TCAAGTATCGTCGGAATGAGCTCTTCCTGGATGTGCTGGAGAGTGTGAACCTGCTCATGTCCCCACAAGG
GCAGGTGCTGAGTGCCCATGTGTCGGGCCGGGTGGTGATGAAGAGCTACCTGAGTGGCATGCCTGAATGC
AAGTTTGGGATGAATGACAAGATTGTTATTGAAAAGCAGGGCAAAGGCACAGCTGATGAAACAAGCAAGA
GCGGGAAGCAATCAATTGCCATTGATGACTGCACCTTCCACCAGTGTGTGCGACTCAGCAAGTTTGACTC
TGAACGCAGCATCAGCTTTATCCCGCCAGATGGAGAGTTTGAGCTTATGAGGTATCGCACAACCAAGGAC
ATCATCCTTCCCTTCCGGGTGATCCCGCTAGTGCGAGAAGTGGGACGCACCAAACTGGAGGTCAAGGTGG
TCATCAAGTCCAACTTTAAACCCTCACTGCTGGCTCAGAAGATCGAGGTGAGGATCCCAACCCCACTGAA
CACAAGCGGGGTGCAGGTGATCTGCATGAAGGGGAAGGCCAAGTACAAGGCCAGCGAGAATGCCATCGTG
TGGAAGATCAAGCGCATGGCAGGCATGAAGGAATCGCAGATCAGCGCAGAGATTGAGCTTCTGCCTACCA
ACGACAAGAAGAAATGGGCTCGACCCCCCATTTCCATGAACTTTGAGGTGCCATTCGCGCCCTCTGGCCT
CAAGGTGCGCTACTTGAAGGTGTTTGAACCGAAGCTGAACTACAGCGACCATGATGTCATCAAATGGGTG
CGCTACATTGGCCGCAGTGGCATTTATGAAACTCGCTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001025205
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001025205.1, NP_001020376.1
RefSeq Size 1952 bp
RefSeq ORF 1302 bp
Locus ID 1173
Cytogenetics 3q27.1
Protein Families Druggable Genome
Protein Pathways Endocytosis, Huntington's disease
Gene Summary 'This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]'
Transcript Variant: This variant (2) lacks three alternate in-frame exons compared to variant 3. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform c.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.