PFN3 (NM_001029886) Human Untagged Clone

CAT#: SC302462

PFN3 (untagged)-Human profilin 3 (PFN3)


  "NM_001029886" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PFN3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PFN3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001029886, the custom clone sequence may differ by one or more nucleotides


ATGGGCGACTGGAAGGTCTACATCAGTGCAGTGCTGCGGGACCAGCGCATCGACGACGTGGCCATCGTGG
GCCATGCGGACAACAGCTGCGTGTGGGCTTCGCGGCCCGGGGGCCTGCTGGCGGCCATCTCGCCGCAGGA
GGTGGGCGTGCTCACGGGGCCGGACAGGCACACCTTCCTGCAGGCGGGCCTGAGCGTGGGGGGCCGCCGC
TGCTGCGTCATCCGCGACCACCTGCTGGCCGAGGGTGACGGCGTGCTGGACGCACGCACCAAGGGGCTGG
ACGCGCGCGCCGTGTGCGTGGGCCGTGCGCCGCGCGCGCTCCTGGTGCTAATGGGCCGACGCGGCGTACA
TGGGGGCATCCTCAACAAGACGGTGCACGAACTCATACGCGGGCTGCGCATGCAGGGCGCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001029886
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001029886.2, NP_001025057.1
RefSeq Size 548 bp
RefSeq ORF 414 bp
Locus ID 345456
Cytogenetics 5q35.3
Protein Pathways Regulation of actin cytoskeleton
Gene Summary The product of this gene belongs to the profilin family of proteins. This protein binds to actin and affects the structure of the cytoskeleton. It also may be involved in spermatogenesis. It is a single exon gene. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.