PQBP1 (NM_001032384) Human Untagged Clone

CAT#: SC302649

PQBP1 (untagged)-Human polyglutamine binding protein 1 (PQBP1), transcript variant 5


  "NM_001032384" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PQBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PQBP1
Synonyms MRX2; MRX55; MRXS3; MRXS8; NPW38; RENS1; SHS
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001032384, the custom clone sequence may differ by one or more nucleotides
ATGCCGCTGCCCGTTGCGCTGCAGACCCGCTTGGCCAAGAGAGGCATCCTCAAACATCTG
GAGCCTGAACCAGAGGAAGAGATCATTGCCGAGGACTATGACGATGATCCTGTGGACTAC
GAGGCCACCAGGTTGGAGGGCCTACCACCAAGCTGGTACAAGGTGTTCGACCCTTCCTGC
GGGCTCCCTTACTACTGGAATGCAGACACAGACCTTGTATCCTGGCTCTCCCCACATGAC
CCCAACTCCGTGGTTACCAAATCGGCCAAGAAGCTCAGAAGCAGTAATGCAGATGCTGAA
GAAAAGTTGGACCGGAGCCATGACAAGTCGGACAGGGGCCATGACAAGTCGGACCGCAGC
CATGAGAAACTAGACAGGGGCCACGACAAGTCAGACCGGGGCCACGACAAGTCTGACAGG
GATCGAGAGCGTGGCTATGACAAGGTAGACAGAGAGAGAGAGCGAGACAGGGAACGGGAT
CGGGACCGCGGGTATGACAAGGCAGACCGGGAAGAGGGCAAAGAACGGCGCCACCATCGC
CGGGAGGAGCTGGCTCCCTATCCCAAGAGCAAGAAGGCAGTAAGCCGAAAGGATGAAGAG
TTAGACCCCATGGACCCTAGCTCATACTCAGACGCCCCCCGGGGCACGTGGTCAACAGGA
CTCCCCAAGCGGAATGAGGCCAAGACTGGCGCTGACACCACAGCAGCTGGGCCCCTCTTC
CAGCAGCGGCCGTATCCATCCCCAGGGGCTGTGCTCCGGGCCAATGCAGAGGCCTCCCGA
ACCAAGCAGCAGGATTGA
Restriction Sites Please inquire     
ACCN NM_001032384
ORF Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001032384.1, NP_001027556.1
RefSeq Size 1002
RefSeq ORF 798
Locus ID 10084
Protein Families Transcription Factors
Protein Pathways Spliceosome
Gene Summary This gene encodes a nuclear polyglutamine-binding protein that is involved with transcription activation. The encoded protein contains a WW domain. Mutations in this gene have been found in patients with Renpenning syndrome 1 and other syndromes with X-linked cognitive disability. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein (isoform 1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.