HNRPH2 (HNRNPH2) (NM_001032393) Human Untagged Clone
CAT#: SC302656
HNRNPH2 (untagged)-Human heterogeneous nuclear ribonucleoprotein H2 (H') (HNRNPH2), transcript variant 2
"NM_001032393" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HNRNPH2 |
Synonyms | FTP3; hnRNPH'; HNRPH'; HNRPH2; MRXSB; NRPH2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001032393, the custom clone sequence may differ by one or more nucleotides
ATGATGCTGAGCACGGAAGGCAGGGAGGGGTTCGTGGTGAAGGTCAGGGGCCTACCCTGGTCCTGCTCAG CCGATGAAGTGATGCGCTTCTTCTCTGATTGCAAGATCCAAAATGGCACATCAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGTGAAGCATTTGTTGAACTTGAATCTGAAGAGGAAGTGAAATTGGCT TTGAAGAAGGACAGAGAAACCATGGGACACAGATACGTTGAAGTATTCAAGTCTAACAGTGTTGAAATGG ATTGGGTGTTGAAGCATACAGGTCCGAATAGCCCTGATACTGCCAACGATGGCTTCGTCCGGCTTAGAGG ACTCCCATTTGGCTGTAGCAAGGAAGAGATTGTTCAGTTCTTTTCAGGGTTGGAAATTGTGCCAAATGGG ATGACACTGCCAGTGGACTTTCAGGGGCGAAGCACAGGGGAAGCCTTTGTGCAGTTTGCTTCACAGGAGA TAGCTGAGAAGGCCTTAAAGAAACACAAGGAAAGAATAGGGCACAGGTACATTGAGATCTTCAAGAGTAG CCGAGCTGAAGTTCGAACCCACTATGATCCCCCTCGAAAGCTCATGGCTATGCAGCGGCCAGGTCCCTAT GATAGGCCGGGGGCTGGCAGAGGGTATAATAGCATTGGCAGAGGAGCTGGGTTTGAAAGGATGAGGCGTG GTGCCTATGGTGGAGGGTATGGAGGCTATGATGACTATGGTGGCTATAATGATGGATATGGCTTTGGGTC TGATAGATTTGGAAGAGACCTCAATTACTGTTTTTCAGGAATGTCTGATCATAGATACGGAGATGGTGGG TCCAGTTTCCAGAGCACCACAGGGCACTGTGTACACATGAGGGGGTTACCTTACAGAGCCACTGAGAATG ATATTTATAATTTCTTCTCACCTCTTAATCCCATGAGAGTACATATTGAAATTGGACCCGATGGCAGAGT TACCGGTGAGGCAGATGTTGAATTTGCTACTCATGAAGATGCTGTGGCAGCTATGGCAAAAGACAAAGCT AATATGCAACACAGATATGTGGAGCTCTTCTTAAATTCTACTGCAGGAACAAGTGGGGGTGCTTACGATC ACAGCTATGTAGAACTTTTTTTGAATTCTACAGCAGGGGCAAGTGGTGGCGCTTATGGTAGCCAAATGAT GGGAGGGATGGGCTTATCCAACCAGTCTAGTTATGGAGGTCCTGCTAGCCAGCAGCTGAGTGGTGGTTAT GGAGGTGGTTATGGTGGTCAGAGCAGTATGAGTGGATATGACCAAGTTCTGCAGGAAAACTCCAGTGACT ATCAGTCAAACCTTGCTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001032393 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001032393.2, NP_001027565.1 |
RefSeq Size | 2380 bp |
RefSeq ORF | 1350 bp |
Locus ID | 3188 |
Cytogenetics | Xq22.1 |
Gene Summary | 'This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that binds to RNAs. It is very similar to the family member HNRPH1. This gene is thought to be involved in Fabray disease and X-linked agammaglobulinemia phenotype. Alternative splicing results in multiple transcript variants encoding the same protein. Read-through transcription between this locus and the ribosomal protein L36a gene has been observed. [provided by RefSeq, Jan 2011]' Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212052 | HNRNPH2 (Myc-DDK-tagged)-Human heterogeneous nuclear ribonucleoprotein H2 (H') (HNRNPH2), transcript variant 2 |
USD 420.00 |
|
RG212052 | HNRNPH2 (GFP-tagged) - Human heterogeneous nuclear ribonucleoprotein H2 (H') (HNRNPH2), transcript variant 2 |
USD 460.00 |
|
RC212052L3 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein H2 (H') (HNRNPH2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC212052L4 | Lenti ORF clone of Human heterogeneous nuclear ribonucleoprotein H2 (H') (HNRNPH2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review