FBXO7 (NM_001033024) Human Untagged Clone
CAT#: SC302674
FBXO7 (untagged)-Human F-box protein 7 (FBXO7), transcript variant 2
"NM_001033024" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FBXO7 |
Synonyms | FBX; FBX07; FBX7; PARK15; PKPS |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001033024, the custom clone sequence may differ by one or more nucleotides
ATGGCCCGGCCTCCCGGGGGCTCTGGTCCCCTCCTCGATTCAGAGCATTCTTCACTCCAGAATAATGAGC AACCCTCTTTGGCCACCAGCTCCAATCAGACTAGCATGCAGGATGAACAACCAAGTGATTCATTCCAAGG ACAGGCAGCCCAGTCTGGTGTTTGGAATGACGACAGTATGTTAGGGCCTAGTCAAAATTTTGAAGCTGAG TCAATTCAAGATAATGCGCATATGGCAGAGGGCACAGGTTTCTATCCCTCAGAACCCATGCTCTGTAGTG AATCGGTGGAAGGGCAAGTGCCACATTCATTAGAGACCTTGTATCAATCAGCTGACTGTTCTGATGCCAA TGATGCCTTGATAGTGTTGATACATCTTCTCATGTTGGAGTCAGGTTACATACCTCAGGGCACCGAAGCC AAAGCACTGTCCATGCCGGAGAAGTGGAAGTTGAGCGGGGTGTATAAGCTGCAGTACATGCATCCTCTCT GCGAGGGCAGCTCCGCTACTCTCACCTGTGTGCCTTTGGGAAACCTGATTGTTGTAAATGCTACACTAAA AATCAACAATGAGATTAGAAGTGTGAAAAGATTGCAGCTGCTACCAGAATCTTTTATTTGCAAAGAGAAA CTAGGGGAAAATGTAGCCAACATATACAAAGATCTTCAGAAACTCTCTCGCCTCTTTAAAGACCAGCTGG TGTATCCTCTTCTGGCTTTTACCCGACAAGCACTGAACCTACCAGATGTATTTGGGTTGGTCGTCCTCCC ATTGGAACTGAAACTACGGATCTTCCGACTTCTGGATGTTCGTTCCGTCTTGTCTTTGTCTGCGGTTTGT CGTGACCTCTTTACTGCTTCAAATGACCCACTCCTGTGGAGGTTTTTATATCTGCGTGATTTTCGAGACA ATACTGTCAGAGTTCAAGACACAGATTGGAAAGAACTGTACAGGAAGAGGCACATACAAAGAAAAGAATC CCCGAAAGGGCGGTTTGTGATGCTCCTGCCATCGTCAACTCACACCATTCCATTCTATCCCAACCCCTTG CACCCTAGGCCATTTCCTAGCTCCCGCCTTCCTCCAGGAATTATCGGGGGTGAATATGACCAAAGACCAA CACTTCCCTATGTTGGAGACCCAATCAGTTCACTCATTCCTGGTCCTGGGGAGACGCCCAGCCAGTTTCC TCCACTGAGACCACGCTTTGATCCAGTTGGCCCACTTCCAGGACCTAACCCCATCTTGCCAGGGCGAGGC GGCCCCAATGACAGATTTCCCTTTAGACCCAGCAGGGGTCGGCCAACTGATGGCCGGCTGTCATTCATGT GA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033024 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001033024.1, NP_001028196.1 |
RefSeq Size | 1758 bp |
RefSeq ORF | 1332 bp |
Locus ID | 25793 |
Cytogenetics | 22q12.3 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it may play a role in regulation of hematopoiesis. Alternatively spliced transcript variants of this gene have been identified with the full-length natures of only some variants being determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains a different 5' UTR and 5' coding region, compared to variant 1. This results in a shorter protein (isoform 2) with a distinct N- terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218979 | FBXO7 (Myc-DDK-tagged)-Human F-box protein 7 (FBXO7), transcript variant 2 |
USD 420.00 |
|
RG218979 | FBXO7 (GFP-tagged) - Human F-box protein 7 (FBXO7), transcript variant 2 |
USD 460.00 |
|
RC218979L3 | Lenti-ORF clone of FBXO7 (Myc-DDK-tagged)-Human F-box protein 7 (FBXO7), transcript variant 2 |
USD 620.00 |
|
RC218979L4 | Lenti-ORF clone of FBXO7 (mGFP-tagged)-Human F-box protein 7 (FBXO7), transcript variant 2 |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review