UBA52 (NM_001033930) Human Untagged Clone

CAT#: SC302780

UBA52 (untagged)-Human ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UBA52
• Synonyms: CEP52; HUBCEP52; L40; RPL40
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001033930, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCAGATCTTTGTGAAGACCCTCACTGGCAAAACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTG
  AGAATGTCAAAGCCAAAATTCAAGACAAGGAGGGTATCCCACCTGACCAGCAGCGTCTGATATTTGCCGG
  CAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTG
  TTGCGCCTGCGAGGTGGCATTATTGAGCCTTCTCTCCGCCAGCTTGCCCAGAAATACAACTGCGACAAGA
  TGATCTGCCGCAAGTGCTATGCTCGCCTTCACCCTCGTGCTGTCAACTGCCGCAAGAAGAAGTGTGGTCA
  CACCAACAACCTGCGTCCCAAGAAGAAGGTCAAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001033930
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001033930.2, NP_001029102.1
• RefSeq Size: 2825 bp
• RefSeq ORF: 387 bp
• Locus ID: 7311
• Cytogenetics: 19p13.11
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: Ribosome
• Gene Summary: 'Ubiquitin is a highly conserved nuclear and cytoplasmic protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein L40 at the C terminus, a C-terminal extension protein (CEP). Multiple processed pseudogenes derived from this gene are present in the genome. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.