KCNIP1 (NM_001034838) Human Untagged Clone

CAT#: SC302800

KCNIP1 (untagged)-Human Kv channel interacting protein 1 (KCNIP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: KCNIP1
• Synonyms: KCHIP1; VABP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001034838, the custom clone sequence may differ by one or more nucleotides
  ATGAGCGGCTGCTCCAAAAGATGCAAGCTTGGGTTCGTGAAATTTGCCCAGACCATCTTT
  AAGCTCATCACTGGGACCCTCAGCAAAGATAAGATTGAAGATGAGCTGGAGATGACCATG
  GTTTGCCATCGGCCCGAGGGACTGGAGCAGCTCGAGGCCCAGACCAACTTCACCAAGAGG
  GAGCTGCAGGTCCTTTATCGAGGCTTCAAAAATGAGTGCCCCAGTGGTGTGGTCAACGAA
  GACACATTCAAGCAGATCTATGCTCAGTTTTTCCCTCATGGAGATGCCAGCACGTATGCC
  CATTACCTCTTCAATGCCTTCGACACCACTCAGACAGGCTCCGTGAAGTTCGAGGACTTT
  GTAACCGCTCTGTCGATTTTATTGAGAGGAACTGTCCACGAGAAACTAAGGTGGACATTT
  AATTTGTATGACATCAACAAGGACGGATACATAAACAAAGAGGAGATGATGGACATTGTC
  AAAGCCATCTATGACATGATGGGGAAATACACATATCCTGTGCTCAAAGAGGACACTCCA
  AGGCAGCATGTGGACGTCTTCTTCCAGAAAATGGACAAAAATAAAGATGGCATCGTAACT
  TTAGATGAATTTCTTGAATCATGTCAGGAGGACGACAACATCATGAGGTCTCTCCAGCTG
  TTTCAAAATGTCATGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_001034838
• ORF Size: 678 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_001034838.1, NP_001030010.1
• RefSeq Size: 1518
• RefSeq ORF: 678
• Locus ID: 30820
• Protein Families: Druggable Genome, Ion Channels: Other
• Gene Summary: This gene encodes a member of the family of cytosolic voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belong to the neuronal calcium sensor (NCS) family of the calcium binding EF-hand proteins. They associate with Kv4 alpha subunits to form native Kv4 channel complexes. The encoded protein may regulate rapidly inactivating (A-type) currents, and hence neuronal membrane excitability, in response to changes in the concentration of intracellular calcium. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
  Transcript Variant: This variant (3, also known as KCNIP1-Ia deltaII) contains an alternate 5' terminal exon and uses an alternate in-frame splice site in the 5' coding region, compared to variant 5. It encodes isoform 3 which has a distinct N-terminus and is shorter than isoform 5.