THYN1 (NM_001037304) Human Untagged Clone
CAT#: SC302878
THYN1 (untagged)-Human thymocyte nuclear protein 1 (THYN1), transcript variant 4
"NM_001037304" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | THYN1 |
Synonyms | HSPC144; MDS012; MY105; THY28; THY28KD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001037304, the custom clone sequence may differ by one or more nucleotides
ATGTCGAGACCCCGGAAGAGGCTGGCTGGGACTTCTGGTTCAGACAAGGGACTATCAGGAAAACGCACCA AAACTGAGAACTCAGGTGAGGCATTAGCTAAAGTGGAGGACTCCAACCCTCAGAAGACTTCAGCCACTAA AAACTGTTTGAAGAATCTAAGCAGCCACTGGCTGATGAAGTCAGAGCCAGAGAGCCGCCTAGAGAAAGGT GTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAACAGACAACATGCTGGGATGGTGTTC GTAACTACCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGGAGAAGAAGCCTTCTTCTACCATAGCAA CTGCAAAGAGCCAGGCATCGCAGGACTCATGAAGATCGTGAAAGAGGCTTACCCAGACCACACACAGTTT GAGAAAAACAATCCCCATTATGACCCATCTAGCAAAGAGGACAACCCTAAGTGGTCCATGAAGAGTTTGA TTTTGTTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037304 |
ORF Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_001037304.1, NP_001032381.1 |
RefSeq Size | 790 |
RefSeq ORF | 501 |
Locus ID | 29087 |
Gene Summary | This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR and lacks an exon in the 3' coding region, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Isoform 2 is also encoded by variant 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202662 | THYN1 (Myc-DDK-tagged)-Human thymocyte nuclear protein 1 (THYN1), transcript variant 4 |
USD 98.00 |
|
RG202662 | THYN1 (GFP-tagged) - Human thymocyte nuclear protein 1 (THYN1), transcript variant 4 |
USD 460.00 |
|
RC202662L3 | Lenti ORF clone of Human thymocyte nuclear protein 1 (THYN1), transcript variant 4, Myc-DDK-tagged |
USD 620.00 |
|
RC202662L4 | Lenti ORF clone of Human thymocyte nuclear protein 1 (THYN1), transcript variant 4, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review