THYN1 (NM_001037304) Human Untagged Clone

CAT#: SC302878

THYN1 (untagged)-Human thymocyte nuclear protein 1 (THYN1), transcript variant 4


  "NM_001037304" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "THYN1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol THYN1
Synonyms HSPC144; MDS012; MY105; THY28; THY28KD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001037304, the custom clone sequence may differ by one or more nucleotides


ATGTCGAGACCCCGGAAGAGGCTGGCTGGGACTTCTGGTTCAGACAAGGGACTATCAGGAAAACGCACCA
AAACTGAGAACTCAGGTGAGGCATTAGCTAAAGTGGAGGACTCCAACCCTCAGAAGACTTCAGCCACTAA
AAACTGTTTGAAGAATCTAAGCAGCCACTGGCTGATGAAGTCAGAGCCAGAGAGCCGCCTAGAGAAAGGT
GTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAACAGACAACATGCTGGGATGGTGTTC
GTAACTACCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGGAGAAGAAGCCTTCTTCTACCATAGCAA
CTGCAAAGAGCCAGGCATCGCAGGACTCATGAAGATCGTGAAAGAGGCTTACCCAGACCACACACAGTTT
GAGAAAAACAATCCCCATTATGACCCATCTAGCAAAGAGGACAACCCTAAGTGGTCCATGAAGAGTTTGA
TTTTGTTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001037304
ORF Size 501 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_001037304.1, NP_001032381.1
RefSeq Size 790
RefSeq ORF 501
Locus ID 29087
Gene Summary This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks an exon in the 3' coding region, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Isoform 2 is also encoded by variant 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.