CA6 (NM_001215) Human Untagged Clone

CAT#: SC302994

CA6 (untagged)-Human carbonic anhydrase VI (CA6)


  "NM_001215" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CA6
Synonyms CA-VI; GUSTIN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001215 edited
ATGAGGGCCCTGGTGCTTCTGCTGTCCCTGTTCCTGCTGGGTGGCCAGGCCCAGCATGTG
TCTGACTGGACCTACTCAGAAGGGGCACTGGACGAAGCGCACTGGCCACAGCACTACCCC
GCCTGTGGGGGCCAGAGACAGTCGCCTATCAACCTACAGAGGACGAAGGTGCGGTACAAC
CCCTCCTTGAAGGGGCTCAATATGACAGGCTATGAGACCCAGGCAGGGGAGTTCCCCATG
GTCAACAATGGCCACACAGTGCAGATCAGCCTGCCCTCCACCATGCGCATGACAGTGGCT
GACGGCACTGTATACATAGCCCAGCAGATGCACTTTCACTGGGGAGGTGCGTCCTCGGAG
ATCAGCGGCTCTGAGCACACCGTGGACGGGATCAGACATGTGATCGAGATTCACATTGTT
CACTACAATTCTAAATACAAGAGCTATGATATAGCCCAAGATGCGCCGGATGGTTTGGCT
GTACTGGCAGCCTTCGTTGAGGTGAAGAATTACCCTGAAAACACTTATTACAGCAACTTC
ATTTCTCATCTGGCCAACATCAAGTACCCAGGACAAAGAACAACCCTGACTGGCCTTGAC
GTTCAGGACATGCTGCCCAGGAACCTCCAGCACTACTACACCTACCATGGCTCACTCACC
ACGCCTCCCTGCACTGAGAACGTCCACTGGTTTGTGCTGGCAGATTTTGTCAAGCTCTCC
AGGACACAGGTTTGGAAGCTGGAGAATTCCTTACTGGATCACCGCAACAAGACCATCCAC
AACGATTACCGCAGGACCCAGCCCCTGAACCACAGAGTGGTGGAATCCAACTTCCCGAAT
CAGGAATACACTCTAGGCTCTGAATTCCAGTTTTACCTACATAAGATTGAGGAAATTCTT
GACTACTTAAGAAGAGCATTGAACTGA
Restriction Sites Please inquire     
ACCN NM_001215
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001215.2, NP_001206.2
RefSeq Size 1339 bp
RefSeq ORF 927 bp
Locus ID 765
Cytogenetics 1p36.23
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Nitrogen metabolism
Gene Summary 'The protein encoded by this gene is one of several isozymes of carbonic anhydrase. This protein is found only in salivary glands and saliva and protein may play a role in the reversible hydratation of carbon dioxide though its function in saliva is unknown. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (1) encodes a 308aa isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.