DAZL (NM_001351) Human Untagged Clone

CAT#: SC303003

DAZL (untagged)-Human deleted in azoospermia-like (DAZL), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DAZL
• Synonyms: DAZH; DAZL1; DAZLA; SPGYLA
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001351, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCTACTGCAAATCCTGAAACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAGTCCTCATCAG
  CTGCAACCAGCCAAGGCTATATTTTACCAGAAGGCAAAATCATGCCAAACACTGTTTTTGTTGGAGGAAT
  TGATGTTAGGATGGATGAAACTGAGATTAGAAGCTTCTTTGCTAGATATGGTTCAGTGAAAGAAGTGAAG
  ATAATCACTGATCGAACTGGTGTGTCCAAAGGCTATGGATTTGTTTCATTTTTTAATGACGTGGATGTGC
  AGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGGAAACA
  AAATTTATGTGCTTATCATGTGCAGCCACGTCCTTTGGTTTTTAATCATCCTCCTCCACCACAGTTTCAG
  AATGTCTGGACTAATCCAAACACTGAAACTTATATGCAGCCCACAACCACGATGAATCCTATAACTCAGT
  ATGTTCAGGCATATCCTACTTACCCAAATTCACCAGTTCAGGTCATCACTGGATATCAGTTGCCTGTATA
  TAATTATCAGATGCCACCACAGTGGCCTGTTGGGGAGCAAAGGAGCTATGTTGTACCTCCGGCTTATTCA
  GCTGTTAACTACCACTGTAATGAAGTTGATCCAGGAGCTGAAGTTGTGCCAAATGAATGTTCAGTTCATG
  AAGCTACTCCACCCTCTGGAAATGGCCCACAAAAGAAATCTGTGGACCGAAGCATACAAACGGTGGTATC
  TTGTCTGTTTAATCCAGAGAACAGACTGAGAAACTCTGTTGTTACTCAAGATGACTACTTCAAGGATAAA
  AGAGTGCATCACTTTAGAAGAAGTCGGGCAATGCTTAAATCTGTTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001351
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001351.3, NP_001342.2
• RefSeq Size: 3054 bp
• RefSeq ORF: 888 bp
• Locus ID: 1618
• Cytogenetics: 3p24.3
• Gene Summary: 'The DAZ (Deleted in AZoospermia) gene family encodes potential RNA binding proteins that are expressed in prenatal and postnatal germ cells of males and females. The protein encoded by this gene is localized to the nucleus and cytoplasm of fetal germ cells and to the cytoplasm of developing oocytes. In the testis, this protein is localized to the nucleus of spermatogonia but relocates to the cytoplasm during meiosis where it persists in spermatids and spermatozoa. Transposition and amplification of this autosomal gene during primate evolution gave rise to the DAZ gene cluster on the Y chromosome. Mutations in this gene have been linked to severe spermatogenic failure and infertility in males. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]'
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 2.