DAZL (NM_001351) Human Untagged Clone

CAT#: SC303003

DAZL (untagged)-Human deleted in azoospermia-like (DAZL), transcript variant 2


  "NM_001351" in other vectors (6)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "DAZL"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DAZL
Synonyms DAZH; DAZL1; DAZLA; SPGYLA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001351, the custom clone sequence may differ by one or more nucleotides


ATGTCTACTGCAAATCCTGAAACTCCAAACTCAACCATCTCCAGAGAGGCCAGCACCCAGTCCTCATCAG
CTGCAACCAGCCAAGGCTATATTTTACCAGAAGGCAAAATCATGCCAAACACTGTTTTTGTTGGAGGAAT
TGATGTTAGGATGGATGAAACTGAGATTAGAAGCTTCTTTGCTAGATATGGTTCAGTGAAAGAAGTGAAG
ATAATCACTGATCGAACTGGTGTGTCCAAAGGCTATGGATTTGTTTCATTTTTTAATGACGTGGATGTGC
AGAAGATAGTAGAATCACAGATAAATTTCCATGGTAAAAAGCTGAAGCTGGGCCCTGCAATCAGGAAACA
AAATTTATGTGCTTATCATGTGCAGCCACGTCCTTTGGTTTTTAATCATCCTCCTCCACCACAGTTTCAG
AATGTCTGGACTAATCCAAACACTGAAACTTATATGCAGCCCACAACCACGATGAATCCTATAACTCAGT
ATGTTCAGGCATATCCTACTTACCCAAATTCACCAGTTCAGGTCATCACTGGATATCAGTTGCCTGTATA
TAATTATCAGATGCCACCACAGTGGCCTGTTGGGGAGCAAAGGAGCTATGTTGTACCTCCGGCTTATTCA
GCTGTTAACTACCACTGTAATGAAGTTGATCCAGGAGCTGAAGTTGTGCCAAATGAATGTTCAGTTCATG
AAGCTACTCCACCCTCTGGAAATGGCCCACAAAAGAAATCTGTGGACCGAAGCATACAAACGGTGGTATC
TTGTCTGTTTAATCCAGAGAACAGACTGAGAAACTCTGTTGTTACTCAAGATGACTACTTCAAGGATAAA
AGAGTGCATCACTTTAGAAGAAGTCGGGCAATGCTTAAATCTGTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001351
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001351.3, NP_001342.2
RefSeq Size 3054 bp
RefSeq ORF 888 bp
Locus ID 1618
Cytogenetics 3p24.3
Gene Summary 'The DAZ (Deleted in AZoospermia) gene family encodes potential RNA binding proteins that are expressed in prenatal and postnatal germ cells of males and females. The protein encoded by this gene is localized to the nucleus and cytoplasm of fetal germ cells and to the cytoplasm of developing oocytes. In the testis, this protein is localized to the nucleus of spermatogonia but relocates to the cytoplasm during meiosis where it persists in spermatids and spermatozoa. Transposition and amplification of this autosomal gene during primate evolution gave rise to the DAZ gene cluster on the Y chromosome. Mutations in this gene have been linked to severe spermatogenic failure and infertility in males. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]'
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 2.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.