ADA2a (TADA2A) (NM_001488) Human Untagged Clone

CAT#: SC303033

TADA2A (untagged)-Human transcriptional adaptor 2A (TADA2A), transcript variant 1


  "NM_001488" in other vectors (4)

Reconstitution Protocol

USD 760.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TADA2A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TADA2A
Synonyms ADA2; ADA2A; hADA2; KL04P; TADA2L
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001488, the custom clone sequence may differ by one or more nucleotides


ATGGACCGTTTGGGTTCCTTTAGCAATGATCCCTCTGATAAGCCACCTTGCCGAGGCTGCTCCTCCTACC
TCATGGAGCCTTATATCAAGTGTGCTGAATGTGGGCCACCTCCTTTTTTCCTCTGCTTGCAGTGTTTCAC
TCGAGGCTTTGAGTACAAGAAACATCAAAGCGATCATACTTATGAAATAATGACTTCAGATTTTCCTGTC
CTTGATCCCAGCTGGACTGCTCAAGAAGAAATGGCCCTTTTAGAAGCTGTGATGGACTGTGGCTTTGGAA
ATTGGCAGGATGTAGCCAATCAAATGTGCACCAAGACCAAGGAGGAGTGTGAGAAGCACTATATGAAGCA
TTTCATCAATAACCCTCTGTTTGCATCTACCCTGCTGAACCTGAAACAAGCAGAGGAAGCAAAAACTGCT
GACACAGCCATTCCATTTCACTCTACAGATGACCCTCCCCGACCTACCTTTGACTCCTTGCTTTCTCGGG
ACATGGCCGGGTACATGCCAGCTCGAGCAGATTTCATTGAGGAATTTGACAATTATGCAGAATGGGACTT
GAGAGACATTGATTTTGTTGAAGATGACTCGGACATTTTACATGCTCTGAAGATGGCTGTGGTAGATATC
TATCATTCCAGGTTAAAGGAGAGACAAAGACGAAAAAAAATTATAAGAGACCATGGATTAATCAACCTTA
GAAAGTTTCAATTAATGGAACGGCGGTATCCCAAGGAGGTCCAGGACCTGTATGAAACAATGAGGCGATT
TGCAAGAATTGTGGGGCCAGTGGAACATGACAAATTCATTGAAAGCCATGCATTGGAATTTGAACTCCGA
AGGGAAATCAAGAGGCTCCAAGAATACAGGACAGCAGGCATTACCAATTTTTGTAGTGCCAGAACCTACG
ATCACCTCAAGAAGACACGGGAGGAAGAGCGCCTTAAACGCACTATGCTCTCAGAAGTTCTCCAGTATAT
CCAGGACAGTAGTGCTTGCCAGCAGTGGCTCCGCCGGCAAGCTGACATTGATTCCGGCCTGAGTCCTTCC
ATTCCAATGGCTTCGAATTCAGGTAGACGGAGTGCACCACCCTTGAACCTCACTGGCCTCCCTGGCACAG
AGAAGCTGAATGAAAAAGAAAAGGAGCTCTGTCAGATGGTGAGGTTGGTCCCTGGAGCCTATTTAGAATA
CAAATCTGCTCTATTGAACGAATGTAACAAGCAAGGAGGCTTAAGACTGGCGCAGGCAAGAGCACTCATC
AAGATAGATGTGAACAAAACCCGGAAAATCTATGATTTCCTCATCAGAGAAGGATACATCACTAAAGGCT
AA


Restriction Sites SgfI-MluI     
ACCN NM_001488
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001488.4, NP_001479.4
RefSeq Size 1886 bp
RefSeq ORF 1332 bp
Locus ID 6871
Cytogenetics 17q12
Protein Families Transcription Factors
Gene Summary 'Many DNA-binding transcriptional activator proteins enhance the initiation rate of RNA polymerase II-mediated gene transcription by interacting functionally with the general transcription machinery bound at the basal promoter. Adaptor proteins are usually required for this activation, possibly to acetylate and destabilize nucleosomes, thereby relieving chromatin constraints at the promoter. The protein encoded by this gene is a transcriptional activator adaptor and has been found to be part of the PCAF histone acetylase complex. Several alternatively spliced transcript variants encoding different isoforms of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2009]'
Transcript Variant: This variant (1) is the predominant transcript and encodes the longest isoform (a). Variants 1 and 3 both encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.