IFNA21 (NM_002175) Human Untagged Clone
CAT#: SC303137
IFNA21 (untagged)-Human interferon, alpha 21 (IFNA21)
"NM_002175" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IFNA21 |
Synonyms | IFN-alphaI; leIF-F; LeIF F |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_002175, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTGTCCTTTTCTTTACTGATGGCCGTGCTGGTGCTCAGCTACAAATCCATCTGTTCTCTGGGCT GTGATCTGCCTCAGACCCACAGCCTGGGTAATAGGAGGGCCTTGATACTCCTGGCACAAATGGGAAGAAT CTCTCCTTTCTCCTGCCTGAAGGACAGACATGACTTTGGATTCCCCCAGGAGGAGTTTGATGGCAACCAG TTCCAGAAGGCTCAAGCCATCTCTGTCCTCCATGAGATGATCCAGCAGACCTTCAATCTCTTCAGCACAA AGGACTCATCTGCTACTTGGGAACAGAGCCTCCTAGAAAAATTTTCCACTGAACTTAACCAGCAGCTGAA TGACCTGGAAGCCTGCGTGATACAGGAGGTTGGGGTGGAAGAGACTCCCCTGATGAATGTGGACTCCATC CTGGCTGTGAAGAAATACTTCCAAAGAATCACTCTTTATCTGACAGAGAAGAAATACAGCCCTTGTGCCT GGGAGGTTGTCAGAGCAGAAATCATGAGATCCTTCTCTTTATCAAAAATTTTTCAAGAAAGATTAAGGAG GAAGGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_002175 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002175.2, NP_002166.2 |
RefSeq Size | 1024 bp |
RefSeq ORF | 570 bp |
Locus ID | 3452 |
Cytogenetics | 9p21.3 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Antigen processing and presentation, Autoimmune thyroid disease, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Jak-STAT signaling pathway, Natural killer cell mediated cytotoxicity, Regulation of autophagy, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway |
Gene Summary | 'This gene is a member of the alpha interferon gene cluster on the short arm of chromosome 9. Interferons are cytokines produced in response to viral infection that mediate the immune response and interfere with viral replication. The encoded protein is a type I interferon and may play a specific role in the antiviral response to rubella virus. [provided by RefSeq, Sep 2011]' |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210115 | IFNA21 (Myc-DDK-tagged)-Human interferon, alpha 21 (IFNA21) |
USD 98.00 |
|
RG210115 | IFNA21 (GFP-tagged) - Human interferon, alpha 21 (IFNA21) |
USD 460.00 |
|
RC210115L1 | Lenti ORF clone of Human interferon, alpha 21 (IFNA21), Myc-DDK-tagged |
USD 768.00 |
|
RC210115L2 | Lenti ORF clone of Human interferon, alpha 21 (IFNA21), mGFP tagged |
USD 620.00 |
|
RC210115L3 | Lenti ORF clone of Human interferon, alpha 21 (IFNA21), Myc-DDK-tagged |
USD 620.00 |
|
RC210115L4 | Lenti ORF clone of Human interferon, alpha 21 (IFNA21), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review