KLRC3 (NM_002261) Human Untagged Clone
CAT#: SC303160
KLRC3 (untagged)-Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1
"NM_002261" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KLRC3 |
Synonyms | NKG2-E; NKG2E |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002261 edited
CCACCATGAGTAAACAAAGAGGAACCTTCTCAGAAGTGAGTCTGGCCCAGGACCCAAAGT GGCAGCAAAGGAAACCTAAAGGCAATAAAAGCTCCATTTCAGGAACCGAACAGGAAATAT TCCAAGTAGAATTAAACCTTCAAAATGCTTCTCTGAATCATCAAGGGATTGATAAAATAT ATGACTGCCAAGGTTTACTGCCACCTCCAGAAAAGCTCACTGCCGAGGTCCTAGGAATCA TTTGCATTGTCCTGATGGCCACTGTGTTAAAAACAATAGTTCTTATTCCTTTCCTGGAGC AGAACAATTCTTCCCCGAATGCAAGAACCCAGAAAGCACGTCATTGTGGCCATTGTCCTG AGGAGTGGATTACATATTCCAACAGTTGTTATTACATTGGTAAGGAAAGAAGAACTTGGG AAGAGAGTTTGCAGGCCTGTGCTTCAAAGAACTCTTCTAGTCTGCTTTGTATAGATAATG AAGAAGAAATGAAATTTCTGGCCAGCATTTTACCTTCCTCATGGATTGGTGTGTTTCGTA ACAGCAGTCATCATCCATGGGTGACAATAAATGGTTTGGCTTTCAAACATGAGATAAAAG ACTCAGATCATGCTGAACGTAACTGTGCAATGCTACATGTACGTGGACTTATATCAGACC AGTGTGGATCTTCAAGAATCATTAGACGGGGTTTCATCATGTTGACCAGGCTGGTCTTGA ACTCCTGAG |
Restriction Sites | Please inquire |
ACCN | NM_002261 |
Insert Size | 700 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002261.2. |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002261.2, NP_002252.2 |
RefSeq Size | 1042 bp |
RefSeq ORF | 723 bp |
Locus ID | 3823 |
Cytogenetics | 12p13.2 |
Protein Families | Transmembrane |
Protein Pathways | Antigen processing and presentation, Natural killer cell mediated cytotoxicity |
Gene Summary | 'Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NK cells preferentially express several calcium-dependent (C-type) lectins, which have been implicated in the regulation of NK cell function. KLRC3 is a member of the NKG2 group which are expressed primarily in natural killer (NK) cells and encodes a family of transmembrane proteins characterized by a type II membrane orientation (extracellular C terminus) and the presence of a C-type lectin domain. The NKG2 gene family is located within the NK complex, a region that contains several C-type lectin genes preferentially expressed on NK cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (1), also known as NKG2-E, represents the longer transcript but encodes the shorter isoform (E). |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223627 | KLRC3 (Myc-DDK-tagged)-Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1 |
USD 420.00 |
|
RG223627 | KLRC3 (GFP-tagged) - Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1 |
USD 460.00 |
|
RC223627L1 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC223627L2 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC223627L3 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC223627L4 | Lenti ORF clone of Human killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review