S100A5 (NM_002962) Human Untagged Clone

CAT#: SC303255

S100A5 (untagged)-Human S100 calcium binding protein A5 (S100A5)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: S100A5
• Synonyms: S100D
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_002962, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGACTCCTCTGGAGAAGGCCCTGACCACTATGGTGACCACGTTTCACAAATATTCGGGGAGAGAGG
  GTAGCAAACTGACCCTGAGTAGGAAGGAACTCAAGGAGCTGATCAAGAAAGAGCTGTGTCTTGGGGAGAT
  GAAGGAGAGCAGCATCGATGACTTGATGAAGAGCCTGGACAAGAACAGCGACCAGGAGATCGACTTCAAG
  GAGTACTCGGTGTTCCTGACCATGCTGTGCATGGCCTACAACGACTTCTTTCTAGAGGACAACAAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_002962
• ORF Size: 279 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_002962.1, NP_002953.2
• RefSeq Size: 710
• RefSeq ORF: 279
• Locus ID: 6276
• Gene Summary: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein has a Ca2+ affinity 20- to 100-fold higher than the other S100 proteins studied under identical conditions. This protein also binds Zn2+ and Cu2+, and Cu2+ strongly which impairs the binding of Ca2+. This protein is expressed in very restricted regions of the adult brain. [provided by RefSeq, Jul 2008]