HMGA2 (NM_003483) Human Untagged Clone
CAT#: SC303313
HMGA2 (untagged)-Human high mobility group AT-hook 2 (HMGA2), transcript variant 1
"NM_003483" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HMGA2 |
Synonyms | BABL; HMGI-C; HMGIC; LIPO; STQTL9 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_003483 edited
CGGGAGGCAGGATGAGCGCACGCGGTGAGGGCGCGGGGCAGCCGTCCACTTCAGCCCAGG GACAACCTGCCGCCCCAGCGCCTCAGAAGAGAGGACGCGGCCGCCCCAGGAAGCAGCAGC AAGAACCAACCGGTGAGCCCTCTCCTAAGAGACCCAGGGGAAGACCCAAAGGCAGCAAAA ACAAGAGTCCCTCTAAAGCAGCTCAAAAGAAAGCAGAAGCCACTGGAGAAAAACGGCCAA GAGGCAGACCTAGGAAATGGCCACAACAAGTTGTTCAGAAGAAGCCTGCTCAGGAGGAAA CTGAAGAGACATCCTCACAAGAGTCTGCCGAAGAGGACTAG |
Restriction Sites | Please inquire |
ACCN | NM_003483 |
ORF Size | 330 bp |
Insert Size | 340 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003483.4. |
Reference Data | |
RefSeq | NM_003483.4, NP_003474.1 |
RefSeq Size | 4150 |
RefSeq ORF | 330 |
Locus ID | 8091 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that belongs to the non-histone chromosomal high mobility group (HMG) protein family. HMG proteins function as architectural factors and are essential components of the enhancesome. This protein contains structural DNA-binding domains and may act as a transcriptional regulating factor. Identification of the deletion, amplification, and rearrangement of this gene that are associated with myxoid liposarcoma suggests a role in adipogenesis and mesenchymal differentiation. A gene knock out study of the mouse counterpart demonstrated that this gene is involved in diet-induced obesity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214629 | HMGA2 (Myc-DDK-tagged)-Human high mobility group AT-hook 2 (HMGA2), transcript variant 1 |
USD 98.00 |
|
RG214629 | HMGA2 (GFP-tagged) - Human high mobility group AT-hook 2 (HMGA2), transcript variant 1 |
USD 460.00 |
|
RC214629L1 | Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC214629L2 | Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC214629L3 | Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC214629L4 | Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review