TWEAK (TNFSF12) (NM_003809) Human Untagged Clone

CAT#: SC303382

TNFSF12 (untagged)-Human tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TNFSF12
• Synonyms: APO3L; DR3LG; TNLG4A; TWEAK
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_003809 edited
  CCCATGGCCGCCCGTCGGAGCCAGAGGCGGAGGGGGCGCCGGGGGGAGCCGGGCACCGCC
  CTGCTGGTCCCGCTCGCGCTGGGCCTGGGCCTGGCGCTGGCCTGCCTCGGCCTCCTGCTG
  GCCGTGGTCAGTTTGGGGAGCCGGGCATCGCTGTCCGCCCAGGAGCCTGCCCAGGAGGAG
  CTGGTGGCAGAGGAGGACCAGGACCCGTCGGAACTGAATCCCCAGACAGAAGAAAGCCAG
  GATCCTGCGCCTTTCCTGAACCGACTAGTTCGGCCTCGCAGAAGTGCACCTAAAGGCCGG
  AAAACACGGGCTCGAAGAGCGATCGCAGCCCATTATGAAGTTCATCCACGACCTGGACAG
  GACGGAGCGCAGGCAGGTGTGGACGGGACAGTGAGTGGCTGGGAGGAAGCCAGAATCAAC
  AGCTCCAGCCCTCTGCGCTACAACCGCCAGATCGGGGAGTTTATAGTCACCCGGGCTGGG
  CTCTACTACCTGTACTGTCAGGTGCACTTTGATGAGGGGAAGGCTGTCTACCTGAAGCTG
  GACTTGCTGGTGGATGGTGTGCTGGCCCTGCGCTGCCTGGAGGAATTCTCAGCCACTGCG
  GCGAGTTCCCTCGGGCCCCAGCTCCGCCTCTGCCAGGTGTCTGGGCTGTTGGCCCTGCGG
  CCAGGGTCCTCCCTGCGGATCCGCACCCTCCCCTGGGCCCATCTCAAGGCTGCCCCCTTC
  CTCACCTACTTCGGACTCTTCCAGGTTCACTGAGGGGCCCTGGTCTCCCCGCAGTCGTCC
  CAGGCTGCCGGCTCCCCTCGACAGCTCTCTGGGCACCCGGTCCCCTCTGCCCCACCCTCA
  GCCGCTCTTTGCTCCAGACCTGCCCCTCCCTCTAGAGGCTGCCTGGGCCTGTTCACGTGT
  TTTCCATCCCACATAAATACAGTATTCCCACTCTTATCTTACAACTCCCCCACCGCCCAC
  TCTCCACCT
  
• Restriction Sites: Please inquire
• ACCN: NM_003809
• ORF Size: 750 bp
• Insert Size: 1000
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003809.2.

Reference Data

• RefSeq: NM_003809.2, NP_003800.1
• RefSeq Size: 1407
• RefSeq ORF: 750
• Locus ID: 8742
• Protein Families: Druggable Genome, Secreted Protein, Transmembrane
• Protein Pathways: Cytokine-cytokine receptor interaction
• Gene Summary: The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This protein is a ligand for the FN14/TWEAKR receptor. This cytokine has overlapping signaling functions with TNF, but displays a much wider tissue distribution. This cytokine, which exists in both membrane-bound and secreted forms, can induce apoptosis via multiple pathways of cell death in a cell type-specific manner. This cytokine is also found to promote proliferation and migration of endothelial cells, and thus acts as a regulator of angiogenesis. Alternative splicing results in multiple transcript variants. Some transcripts skip the last exon of this gene and continue into the second exon of the neighboring TNFSF13 gene; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
  Transcript Variant: This variant (1) represents the shorter transcript but encodes the functional protein.