HESX1 (NM_003865) Human Untagged Clone

CAT#: SC303393

HESX1 (untagged)-Human HESX homeobox 1 (HESX1)


  "NM_003865" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HESX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HESX1
Synonyms ANF; CPHD5; RPX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_003865, the custom clone sequence may differ by one or more nucleotides


ATGTCTCCCAGCCTTCAGGAAGGCGCTCAGCTCGGGGAAAACAAACCCTCAACTTGCTCCTTTTCAATTG
AGAGAATCTTAGGACTGGACCAGAAGAAAGACTGTGTTCCATTAATGAAACCCCACAGGCCCTGGGCAGA
CACCTGCAGCTCATCAGGGAAAGATGGTAACTTATGTCTACATGTCCCAAATCCTCCCAGTGGGATTTCA
TTCCCTAGCGTGGTGGATCACCCAATGCCAGAAGAAAGAGCTTCGAAATATGAAAATTACTTTTCAGCCT
CAGAAAGACTGTCTTTGAAAAGAGAGTTGAGTTGGTATAGAGGCCGAAGACCAAGAACTGCTTTTACTCA
AAACCAGATTGAAGTGTTAGAAAATGTCTTTAGAGTAAACTGCTATCCTGGTATCGATATTAGAGAAGAC
TTAGCTCAAAAATTGAATCTAGAGGAAGACAGAATCCAGATTTGGTTTCAAAATCGGCGTGCAAAACTGA
AAAGGTCCCATAGAGAATCACAGTTTCTAATGGCGAAAAAAAATTTCAACACAAATCTGCTGGAATAG


Restriction Sites SgfI-MluI     
ACCN NM_003865
ORF Size 558 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_003865.2, NP_003856.1
RefSeq Size 1182
RefSeq ORF 558
Locus ID 8820
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a conserved homeobox protein that is a transcriptional repressor in the developing forebrain and pituitary gland. Mutations in this gene are associated with septooptic dysplasia, HESX1-related growth hormone deficiency, and combined pituitary hormone deficiency. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.