FGF16 (NM_003868) Human Untagged Clone

CAT#: SC303395

FGF16 (untagged)-Human fibroblast growth factor 16 (FGF16)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FGF16
• Synonyms: FGF-16; MF4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_003868 edited
  ATGGCAGAGGTGGGGGGCGTCTTCGCCTCCTTGGACTGGGATCTACACGGCTTCTCCTCG
  TCTCTGGGGAACGTGCCCTTAGCTGACTCCCCAGGTTTCCTGAACGAGCGCCTGGGCCAA
  ATCGAGGGGAAGCTGCAGCGTGGCTCACCCACAGACTTCGCCCACCTGAAGGGGATCCTG
  CGGCGCCGCCAGCTCTACTGCCGCACCGGCTTCCACCTGGAGATCTTCCCCAACGGCACG
  GTGCACGGGACCCGCCACGACCACAGCCGCTTCGGAATCCTGGAGTTTATCAGCCTGGCT
  GTGGGGCTGATCAGCATCCGGGGAGTGGACTCTGGCCTGTACCTAGGAATGAATGAGCGA
  GGAGAACTCTATGGGTCGAAGAAACTCACACGTGAATGTGTTTTCCGGGAACAGTTTGAA
  GAAAACTGGTACAACACCTATGCCTCAACCTTGTACAAACATTCGGACTCAGAGAGACAG
  TATTACGTGGCCCTGAACAAAGATGGCTCACCCCGGGAGGGATACAGGACTAAACGACAC
  CAGAAATTCACTCACTTTTTACCCAGGCCTGTAGATCCTTCTAAGTTGCCCTCCATGTCC
  AGAGACCTCTTTCACTATAGGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_003868
• ORF Size: 624 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.

Reference Data

• RefSeq: NM_003868.1, NP_003859.1
• RefSeq Size: 624
• RefSeq ORF: 624
• Locus ID: 8823
• Protein Families: Secreted Protein
• Protein Pathways: MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
• Gene Summary: This gene encodes a member of a family of proteins that are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene is expressed in cardiac cells and is required for proper heart development. Mutation in this gene was also observed in individuals with metacarpal 4-5 fusion. [provided by RefSeq, Mar 2014]