WISP3 (NM_003880) Human Untagged Clone
CAT#: SC303396
WISP3 (untagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1
"NM_003880" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WISP3 |
Synonyms | LIBC; PPAC; PPD; WISP-3; WISP3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_003880, the custom clone sequence may differ by one or more nucleotides
ATGCAGGGGCTCCTCTTCTCCACTCTTCTGCTTGCTGGCCTGGCACAGTTCTGCTGCAGGGTACAGGGCA CTGGACCATTAGATACAACACCTGAAGGAAGGCCTGGAGAAGTGTCAGATGCACCTCAGCGTAAACAGTT TTGTCACTGGCCCTGCAAATGCCCTCAGCAGAAGCCCCGTTGCCCTCCTGGAGTGAGCCTGGTGAGAGAT GGCTGTGGATGCTGTAAAATCTGTGCCAAGCAACCAGGGGAAATCTGCAATGAAGCTGACCTCTGTGACC CACACAAAGGGCTGTATTGTGACTACTCAGTAGACAGGCCTAGGTACGAGACTGGAGTGTGTGCATACCT TGTAGCTGTTGGGTGCGAGTTCAACCAGGTACATTATCATAATGGCCAAGTGTTTCAGCCCAACCCCTTG TTCAGCTGCCTCTGTGTGAGTGGGGCCATTGGATGCACACCTCTGTTCATACCAAAGCTGGCTGGCAGTC ACTGCTCTGGAGCTAAAGGTGGAAAGAAGTCTGATCAGTCAAACTGTAGCCTGGAACCATTACTACAGCA GCTTTCAACAAGCTACAAAACAATGCCAGCTTATAGAAATCTCCCACTTATTTGGAAAAAAAAATGTCTT GTGCAAGCAACAAAATGGACTCCCTGCTCCAGAACATGTGGGATGGGAATATCTAACAGGGTGACCAATG AAAACAGCAACTGTGAAATGAGAAAAGAGAAAAGACTGTGTTACATTCAGCCTTGCGACAGCAATATATT AAAGACAATAAAGATTCCCAAAGGAAAAACATGCCAACCTACTTTCCAACTCTCCAAAGCTGAAAAATTT GTCTTTTCTGGATGCTCAAGTACTCAGAGTTACAAACCCACTTTTTGTGGAATATGCTTGGATAAGAGAT GCTGTATCCCTAATAAGTCTAAAATGATTACTATTCAATTTGATTGCCCAAATGAGGGGTCATTTAAATG GAAGATGCTGTGGATTACATCTTGTGTGTGTCAGAGAAACTGCAGAGAACCTGGAGATATATTTTCTGAG CTCAAGATTCTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_003880 |
ORF Size | 1065 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_003880.3, NP_003871.1 |
RefSeq Size | 1252 |
RefSeq ORF | 1065 |
Locus ID | 8838 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein |
Gene Summary | This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene is overexpressed in colon tumors. It may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Mutations of this gene are associated with progressive pseudorheumatoid dysplasia, an autosomal recessive skeletal disorder, indicating that the gene is essential for normal postnatal skeletal growth and cartilage homeostasis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) has an alternate splice pattern near the 5' end and uses a downstream start codon, compared to variant 3. The resulting isoform (1) has a shorter N-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213927 | WISP3 (Myc-DDK-tagged)-Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1 |
USD 420.00 |
|
RG213927 | WISP3 (GFP-tagged) - Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1 |
USD 460.00 |
|
RC213927L3 | Lenti ORF clone of Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC213927L4 | Lenti ORF clone of Human WNT1 inducible signaling pathway protein 3 (WISP3), transcript variant 1, mGFP tagged |
USD 768.00 |
{0} Product Review(s)
Be the first one to submit a review