Persephin (PSPN) (NM_004158) Human Untagged Clone

CAT#: SC303442

PSPN (untagged)-Human persephin (PSPN)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PSPN
• Synonyms: PSP
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_004158 edited
  ATGGCCGTAGGGAAGTTCCTGCTGGGCTCCCTGCTGCTCCTGTCCCTGCAGCTGGGACAG
  GGCTGGGGCCCCGATGCCCGTGGGGTTCCCGTGGCCGATGGAGAGTTCTCGTCTGAACAG
  GTGGCAAAGGCTGGAGGGACCTGGCTGGGCACCCACCGCCCCCTTGCCCGCCTGCGCCGA
  GCCCTGTCTGGTCCATGCCAGCTGTGGAGCCTGACCCTGTCCGTGGCAGAGCTAGGCCTG
  GGCTACGCCTCAGAGGAGAAGGTCATCTTCCGCTACTGCGCCGGCAGCTGCCCCCGTGGT
  GCCCGCACCCAGCATGGCCTGGCGCTGGCCCGGCTGCAGGGCCAGGGCCGAGCCCACGGC
  GGGCCCTGCTGCCGGCCCACTCGCTACACCGACGTGGCCTTCCTCGATGACCGCCACCGC
  TGGCAGCGGCTGCCCCAGCTCTCGGCGGCTGCCTGCGGCTGTGGTGGCTGA
  
• Restriction Sites: Please inquire
• ACCN: NM_004158
• Insert Size: 500 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_004158.2, NP_004149.1
• RefSeq Size: 471 bp
• RefSeq ORF: 471 bp
• Locus ID: 5623
• Cytogenetics: 19p13.3
• Protein Families: Secreted Protein
• Gene Summary: 'This gene encodes a secreted ligand of the GDNF (glial cell line-derived neurotrophic factor) subfamily and TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein signals through the RET receptor tyrosine kinase and a GPI-linked coreceptor, and promotes survival of neuronal populations. This protein may play a role in cell death, and nervous system development and function. Elevated expression of this gene has been observed in oral squamous cell carcinoma. [provided by RefSeq, Aug 2016]'