BPY2 (NM_004678) Human Untagged Clone

CAT#: SC303518

BPY2 (untagged)-Human basic charge, Y-linked, 2 (BPY2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BPY2
• Synonyms: BPY2A; VCY2; VCY2A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_004678, the custom clone sequence may differ by one or more nucleotides
  ATGATGACGCTTGTCCCCAGAGCCAGGACACGTGCAGGACAGGATCATTACTCTCATCCC
  TGCCCCAGATTTTCACAGGTGCTGCTTACAGAGGGCATCATGACATATTGCTTGACAAAG
  AACCTAAGTGATGTTAATATTCTGCATAGGTTGCTAAAAAATGGGAATGTGAGAAATACC
  TTGCTTCAGTCCAAAGTGGGCTTGCTGACATATTATGTGAAACTGTACCCGGGTGAAGTG
  ACTCTTCTGACTAGGCCCAGCATACAAATGAGATTATGCTGTATCACTGGCTCAGTGTCG
  AGGCCCAGATCACAGAAGTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_004678
• ORF Size: 321 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_004678.1, NP_004669.1
• RefSeq Size: 1212
• RefSeq ORF: 321
• Locus ID: 9083
• Gene Summary: This gene is located in the nonrecombining portion of the Y chromosome, and expressed specifically in testis. The encoded protein interacts with ubiquitin protein ligase E3A and may be involved in male germ cell development and male infertility. Three nearly identical copies of this gene exist on chromosome Y; two copies are part of a palindromic region. This record represents the copy outside of the palidromic region. [provided by RefSeq, Jul 2008]