TAL2 (NM_005421) Human Untagged Clone

CAT#: SC303640

TAL2 (untagged)-Human T-cell acute lymphocytic leukemia 2 (TAL2)


  "NM_005421" in other vectors (4)

Reconstitution Protocol

USD 420.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "TAL2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAL2
Synonyms bHLHa19; T-cell acute lymphocytic leukemia 2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005421 edited
CCCTGAGGGCCCTTTCTCTTTCCATCTCAGGAACTCAAACATGACCAGGAAGATCTTCAC
AAATACCAGGGAGCGGTGGAGGCAGCAGAATGTCAACAGCGCCTTTGCCAAGCTGAGGAA
GCTCATCCCCACTCACCCTCCAGACAAAAAGCTGAGCAAAAATGAAACGCTTCGCCTGGC
AATGAGGTATATCAACTTCTTGGTCAAGGTCTTGGGGGAGCAAAGCCTGCAACAAACGGG
AGTGGCTGCTCAGGGGAACATTCTGGGGCTCTTCCCTCAAGGACCCCACCTGCCAGGCCT
GGAGGACAGAACTCTGCTTGAGAACTACCAGGTTCCTTCACCTGGTCCAAGCCACCACAT
TCCTTAGTGTGGCTCTGGCTGTCATCTCC
Restriction Sites Please inquire     
ACCN NM_005421
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005421.1, NP_005412.1
RefSeq Size 327 bp
RefSeq ORF 327 bp
Locus ID 6887
Cytogenetics 9q31.2
Protein Families Druggable Genome
Gene Summary 'This intronless gene encodes a helix-loop-helix protein. Translocations between this gene on chromosome 9 and the T-cell receptor beta-chain locus on chromosome 7 have been associated with activation of the T-cell acute lymphocytic leukemia 2 gene and T-cell acute lymphoblastic leukemia. [provided by RefSeq, Mar 2009]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.