TAF13 (NM_005645) Human Untagged Clone

CAT#: SC303676

TAF13 (untagged)-Human TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa (TAF13)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAF13
• Synonyms: MRT60; TAF(II)18; TAF2K; TAFII-18; TAFII18
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_005645, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGATGAGGAAGAAGACCCCACGTTTGAGGAAGAAAATGAAGAAATTGGAGGAGGTGCAGAAGGTG
  GACAGGGTAAAAGAAAGAGACTTTTTTCTAAAGAATTGCGATGTATGATGTATGGCTTTGGGGATGACCA
  GAATCCTTATACTGAGTCAGTGGATATTCTTGAAGATCTTGTCATAGAGTTTATCACTGAAATGACTCAC
  AAGGCAATGTCAATTGGAAGACAAGGTCGAGTACAAGTTGAAGATATCGTCTTCTTGATTCGAAAGGACC
  CAAGGAAGTTTGCCAGGGTTAAAGACTTGCTTACTATGAATGAAGAATTGAAACGAGCTAGAAAAGCATT
  TGATGAAGCAAATTATGGATCTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_005645
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_005645.3, NP_005636.1
• RefSeq Size: 577 bp
• RefSeq ORF: 375 bp
• Locus ID: 6884
• Cytogenetics: 1p13.3
• Protein Families: Transcription Factors
• Protein Pathways: Basal transcription factors
• Gene Summary: 'Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes a small subunit associated with a subset of TFIID complexes. This subunit interacts with TBP and with two other small subunits of TFIID, TAF10 and TAF11. There is a pseudogene located on chromosome 6. [provided by RefSeq, Jul 2008]'