Uroplakin II (UPK2) (NM_006760) Human Untagged Clone

CAT#: SC303820

UPK2 (untagged)-Human uroplakin 2 (UPK2)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: UPK2
• Synonyms: UP2; UPII
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_006760 edited
  GCCCTTTGCCAGCACCTATTCCACCTCCCAGCCCAGCATGGCACCCCTGCTGCCCATCCG
  GACCTTGCCCTTGATCCTGATTCTGCTGGCTCTGCTGTCCCCAGGGGCTGCAGACTTCAA
  CATCTCAAGCCTCTCTGGTCTGCTGTCCCCGGCACTAACGGAGAGCCTGCTGGTTGCCTT
  GCCCCCCTGTCACCTCACAGGAGGCAATGCCACACTGATGGTCCGGAGAGCCAATGACAG
  CAAAGTGGTGACGTCCAGCTTTGTGGTGCCTCCGTGCCGTGGGCGCAGGGAACTGGTGAG
  TGTGGTGGACAGTGGTGCTGGCTTCACAGTCACTCGGCTCAGTGCATACCAGGTGACAAA
  CCTCGTGCCAGGAACCAAATTCTACATTTCCTACCTAGTGAAGAAGGGGACAGCCACTGA
  GTCCAGCAGAGAGATCCCAATGTCCACACTCCCTCGAAGGAACATGGAATCCATTGGGCT
  GGGTATGGCCCGCACAGGGGGCATGGTGGTCATCACGGTGCTGCTCTCTGTCGCCATGTT
  CCTGCTGGTGCTGGGCTTCATCATTGCCCTGGCACTGGGCTCCCGCAAGTAAGGAGGTCT
  GCCCGGAGCAGCAGCTTCTCCAGGAAGCCCAGGGCACCATCCAGCTCCCCAGCCCACCTG
  CTCCCAGGCCCCAGGCCTGTGGCTCCCTTGGTGCCCTCGCCTCCTCCTCCTGCCCTCCTC
  TCCCCTAGAGCCCTCTCCTCCCTCTGTCCCTCTCCTTGCCCCCAGTGCCTCACCTTCCAA
  CACTCCATTATTCCTCTCACCCCACTCCTGTCA
  
• Restriction Sites: Please inquire
• ACCN: NM_006760
• Insert Size: 800 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006760.1.
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006760.1, NP_006751.1
• RefSeq Size: 932 bp
• RefSeq ORF: 555 bp
• Locus ID: 7379
• Cytogenetics: 11q23.3
• Protein Families: Transmembrane
• Gene Summary: 'This gene encodes one of the proteins of the highly conserved urothelium-specific integral membrane proteins of the asymmetric unit membrane which forms urothelium apical plaques in mammals. The asymmetric unit membrane is believed to strengthen the urothelium by preventing cell rupture during bladder distention. The encoded protein is expressed in the peripheral blood of bladder cancer patients with transitional cell carcinomas.[provided by RefSeq, Sep 2009]'