INMT (NM_006774) Human Untagged Clone
CAT#: SC303823
INMT (untagged)-Human indolethylamine N-methyltransferase (INMT), transcript variant 1
"NM_006774" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | INMT |
Synonyms | TEMT |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_006774, the custom clone sequence may differ by one or more nucleotides
ATGAAGGGTGGCTTCACTGGGGGTGATGAGTACCAGAAGCACTTCCTGCCCAGGGACTACTTGGCTACTT ACTACAGCTTCGATGGCAGCCCCTCACCCGAGGCCGAGATGCTGAAGTTTAACTTGGAATGTCTCCACAA GACCTTCGGCCCTGGAGGCCTCCAAGGGGACACGCTGATTGACATTGGCTCAGGTCCTACCATCTACCAA GTTCTTGCTGCCTGTGATTCCTTCCAAGACATCACTCTCTCCGACTTTACCGACCGCAACCGGGAGGAGC TGGAAAAGTGGCTGAAGAAGGAGCCGGGGGCCTATGACTGGACCCCAGCGGTGAAATTCGCCTGTGAGCT GGAAGGAAACAGCGGCCGATGGGAGGAGAAGGAGGAGAAGCTGCGGGCAGCGGTGAAGCGGGTGCTCAAG TGCGATGTCCACCTGGGCAACCCGCTGGCCCCGGCTGTGTTGCCTCTCGCCGACTGTGTGCTCACCCTGC TGGCCATGGAGTGTGCCTGCTGTAGCCTTGATGCCTACCGCGCTGCCCTGTGCAACCTTGCCTCACTGCT CAAGCCGGGTGGCCACCTGGTGACCACTGTCACGCTTCGGCTCCCGTCCTACATGGTGGGGAAGCGTGAA TTTTCCTGCGTGGCCCTGGAGAAAGAGGAGGTGGAGCAGGCTGTCCTGGATGCTGGCTTTGACATTGAAC AGCTCCTACACAGTCCCCAGAGCTACTCTGTCACCAATGCTGCCAACAATGGGGTCTGCTTCATTGTGGC TCGCAAGAAGCCTGGGCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_006774 |
ORF Size | 792 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_006774.4, NP_006765.4 |
RefSeq Size | 2639 |
RefSeq ORF | 792 |
Locus ID | 11185 |
Protein Pathways | Tryptophan metabolism |
Gene Summary | N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218678 | INMT (Myc-DDK-tagged)-Human indolethylamine N-methyltransferase (INMT), transcript variant 1 |
USD 420.00 |
|
RG218678 | INMT (GFP-tagged) - Human indolethylamine N-methyltransferase (INMT), transcript variant 1 |
USD 460.00 |
|
RC218678L3 | Lenti ORF clone of Human indolethylamine N-methyltransferase (INMT), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC218678L4 | Lenti ORF clone of Human indolethylamine N-methyltransferase (INMT), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review