INMT (NM_006774) Human Untagged Clone

CAT#: SC303823

INMT (untagged)-Human indolethylamine N-methyltransferase (INMT), transcript variant 1


  "NM_006774" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "INMT"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol INMT
Synonyms TEMT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_006774, the custom clone sequence may differ by one or more nucleotides


ATGAAGGGTGGCTTCACTGGGGGTGATGAGTACCAGAAGCACTTCCTGCCCAGGGACTACTTGGCTACTT
ACTACAGCTTCGATGGCAGCCCCTCACCCGAGGCCGAGATGCTGAAGTTTAACTTGGAATGTCTCCACAA
GACCTTCGGCCCTGGAGGCCTCCAAGGGGACACGCTGATTGACATTGGCTCAGGTCCTACCATCTACCAA
GTTCTTGCTGCCTGTGATTCCTTCCAAGACATCACTCTCTCCGACTTTACCGACCGCAACCGGGAGGAGC
TGGAAAAGTGGCTGAAGAAGGAGCCGGGGGCCTATGACTGGACCCCAGCGGTGAAATTCGCCTGTGAGCT
GGAAGGAAACAGCGGCCGATGGGAGGAGAAGGAGGAGAAGCTGCGGGCAGCGGTGAAGCGGGTGCTCAAG
TGCGATGTCCACCTGGGCAACCCGCTGGCCCCGGCTGTGTTGCCTCTCGCCGACTGTGTGCTCACCCTGC
TGGCCATGGAGTGTGCCTGCTGTAGCCTTGATGCCTACCGCGCTGCCCTGTGCAACCTTGCCTCACTGCT
CAAGCCGGGTGGCCACCTGGTGACCACTGTCACGCTTCGGCTCCCGTCCTACATGGTGGGGAAGCGTGAA
TTTTCCTGCGTGGCCCTGGAGAAAGAGGAGGTGGAGCAGGCTGTCCTGGATGCTGGCTTTGACATTGAAC
AGCTCCTACACAGTCCCCAGAGCTACTCTGTCACCAATGCTGCCAACAATGGGGTCTGCTTCATTGTGGC
TCGCAAGAAGCCTGGGCCCTGA


Restriction Sites SgfI-MluI     
ACCN NM_006774
ORF Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_006774.4, NP_006765.4
RefSeq Size 2639
RefSeq ORF 792
Locus ID 11185
Protein Pathways Tryptophan metabolism
Gene Summary N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.