SOX21 (NM_007084) Human Untagged Clone

CAT#: SC303873

SOX21 (untagged)-Human SRY (sex determining region Y)-box 21 (SOX21)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SOX21
• Synonyms: SOX25
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF sequence for NM_007084 edited
  ATGTCCAAGCCGGTGGACCACGTCAAGCGGCCCATGAACGCCTTCATGGTGTGGTCGCGG
  GCTCAGCGGCGCAAGATGGCCCAGGAGAACCCCAAGATGCACAACTCGGAGATCAGCAAG
  CGCTTGGGCGCCGAGTGGAAACTGCTCACAGAGTCGGAGAAGCGGCCGTTCATCGACGAG
  GCCAAGCGTCTACGCGCCATGCACATGAAGGAGCACCCCGACTACAAGTACCGGCCGCGG
  CGCAAGCCCAAGACGCTGCTCAAGAAGGACAAGTTCGCCTTCCCGGTGCCCTACGGCCTG
  GGCGGCGTGGCGGACGCCGAGCACCCTGCGCTCAAGGCGGGCGCCGGGCTGCACGCGGGG
  GCGGGCGGCGGCCTGGTGCCTGAGTCGCTGCTCGCCAATCCCGAGAAGGCGGCCGCGGCC
  GCCGCCGCTGCCGCCGCACGCGTCTTCTTCCCGCAGTCGGCCGCTGCCGCCGCCGCTGCC
  GCCGCCGCCGCCGCCGCGGGCAGCCCCTACTCGCTGCTCGACCTGGGCTCCAAAATGGCA
  GAGATCTCGTCGTCCTCGTCCGGCCTCCCGTACGCGTCGTCGCTGGGCTACCCGACCGCG
  GGCGCGGGCGCCTTCCACGGCGCGGCGGCGGCGGCTGCAGCGGCGGCCGCCGCCGCCGGG
  GGGCACACGCACTCGCACCCCAGCCCCGGCAACCCGGGCTACATGATCCCGTGCAACTGC
  AGCGCGTGGCCCAGCCCCGGGCTGCAGCCGCCGCTCGCCTACATCCTGCTGCCGGGCATG
  GGCAAGCCCCAGCTGGACCCCTACCCCGCGGCCTACGCTGCCGCGCTATGA
  
• Restriction Sites: NotI-NotI
• ACCN: NM_007084
• ORF Size: 831 bp
• Insert Size: 2900
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: The open reading frame of this clone has been fully sequenced and found one SNPs within the protein associated with this reference, NM_007084.2. This SNP doesn't change amino acid.

Reference Data

• RefSeq: NM_007084.2, NP_009015.1
• RefSeq Size: 2537
• RefSeq ORF: 831
• Locus ID: 11166
• Gene Summary: SRY-related HMG-box (SOX) genes encode a family of DNA-binding proteins containing a 79-amino acid HMG (high mobility group) domain that shares at least 50% sequence identity with the DNA-binding HMG box of the SRY protein (MIM 480000). SOX proteins are divided into 6 subgroups based on sequence similarity within and outside of the HMG domain. For additional background information on SOX genes, see SOX1 (MIM 602148). [supplied by OMIM, Apr 2004]