DUX5 (NM_012149) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | DUX5 |
Synonyms | DUX1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_012149, the custom clone sequence may differ by one or more nucleotides
ATGCCGGCTGAGGTGCACGGGAGCCCGCCCGCCTCTCTCTGCCCGTGTCAGTCCGTGAAATTCCGGCCGG GGCTCCCTGAGATGGCCCTCCTGACAGCTTTGGACGACACCCTCCCCGAGGAAGCCCAGGGACCGGGAAG GCGAATGATACTCCTTTCGACCCCGAGTCAAAGTGATGCCCTGCGAGCCTGCTTTGAGCGGAACCTGTAC CCGGGCATTGCCACCAAAGAAGAGCTGGCCCAGGGCATCGACATTCCGGAGCCCAGGGTCCAGATTTGGT TTCAGAATGAGAGATCATGCCAGTTGAGGCAGCACCGGCGGCAATCTCGGCCCTGGCCCGGGAGACGTGA CCCGCAAAAAGGCAGACGAAAGCGGACTGCCATCACCGGATCCCAAACCGCCCTGCTCCTCCGAGCCTTT GAGAAGGATCGCTTTCCAGGCATTGCTGCCAGGGAAGAGCTGGCCAGAGAGACGGGCCTCCCGGAGTCCA GGATTCAGATCTGGTTTCAGAATCGAAGAGCCAGGCACCGGGGACAGTCTGGCAGGGCGCCCACGCAGGC AAGCATCCGGTGCAATGCAGCCCCAATTGGGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_012149 |
ORF Size | 594 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_012149.2, NP_036281.2 |
RefSeq Size | 594 |
RefSeq ORF | 594 |
Locus ID | 26581 |
Gene Summary | The human genome contains hundreds of repeats of the 3.3-kb family in regions associated with heterochromatin. The DUX gene family, including DUX5, resides within these 3.3-kb repeated elements (Beckers et al., 2001 [PubMed 11245978]). See DUX4 (MIM 606009). [supplied by OMIM, Mar 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218348 | DUX5 (Myc-DDK-tagged)-Human double homeobox 5 (DUX5) |
USD 420.00 |
|
RG218348 | DUX5 (GFP-tagged) - Human double homeobox 5 (DUX5) |
USD 460.00 |
|
RC218348L3 | Lenti ORF clone of Human double homeobox 5 (DUX5), Myc-DDK-tagged |
USD 620.00 |
|
RC218348L4 | Lenti ORF clone of Human double homeobox 5 (DUX5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review