PAX8 (NM_013953) Human Untagged Clone

CAT#: SC304021

PAX8 (untagged)-Human paired box 8 (PAX8), transcript variant PAX8D


  "NM_013953" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PAX8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PAX8
Synonyms OTTHUMP00000158659; OTTHUMP00000158660; paired box 8; paired domain gene 8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_013953, the custom clone sequence may differ by one or more nucleotides


ATGCCTCACAACTCCATCAGATCTGGCCATGGAGGGCTGAACCAGCTGGGAGGGGCCTTTGTGAATGGCA
GACCTCTGCCGGAAGTGGTCCGCCAGCGCATCGTAGACCTGGCCCACCAGGGTGTAAGGCCCTGCGACAT
CTCTCGCCAGCTCCGCGTCAGCCATGGCTGCGTCAGCAAGATCCTTGGCAGGTACTACGAGACTGGCAGC
ATCCGGCCTGGAGTGATAGGGGGCTCCAAGCCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATTGGGG
ACTACAAACGCCAGAACCCTACCATGTTTGCCTGGGAGATCCGAGACCGGCTCCTGGCTGAGGGCGTCTG
TGACAATGACACTGTGCCCAGTGTCAGCTCCATTAATAGAATCATCCGGACCAAAGTGCAGCAACCATTC
AACCTCCCTATGGACAGCTGCGTGGCCACCAAGTCCCTGAGTCCCGGACACACGCTGATCCCCAGCTCAG
CTGTAACTCCCCCGGAGTCACCCCAGTCGGATTCCCTGGGCTCCACCTACTCCATCAATGGGCTCCTGGG
CATCGCTCAGCCTGGCAGCGACAAGAGGAAAATGGATGACAGTGATCAGGATAGCTGCCGACTAAGCATT
GACTCACAGAGCAGCAGCAGCGGACCCCGAAAGCACCTTCGCACGGATGCCTTCAGCCAGCACCACCTCG
AGCCGCTCGAGTGCCCATTTGAGCGGCAGCACTACCCAGAGGCCTATGCCTCCCCCAGCCACACCAAAGG
CGAGCAGGGCGAGAGATGGTGGGGCCCACGCTGCCCGGATACCCACCCCACATCCCCACCAGCGGACAGG
GCAGCTATGCCTCCTCTGCCATCGCAGGCATGGTGGCAGGAAGTGAATACTCTGGCAATGCCTATGGCCA
CACCCCCTACTCCTCCTACAGCGAGGCCTGGCGCTTCCCCAACTCCAGCTTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_013953
ORF Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_013953.3, NP_039247.1
RefSeq Size 3755
RefSeq ORF 966
Locus ID 7849
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Pathways in cancer, Thyroid cancer
Gene Summary This gene encodes a member of the paired box (PAX) family of transcription factors. Members of this gene family typically encode proteins that contain a paired box domain, an octapeptide, and a paired-type homeodomain. This nuclear protein is involved in thyroid follicular cell development and expression of thyroid-specific genes. Mutations in this gene have been associated with thyroid dysgenesis, thyroid follicular carcinomas and atypical follicular thyroid adenomas. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (PAX8D) lacks two alternate exons, compared to variant PAX8A, that results in a frameshift and an early stop codon. The encoded isoform (PAX8D) is shorter and has a distinct C-terminus compared to isoform PAX8A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.