OBP2A (NM_014582) Human Untagged Clone

CAT#: SC304133

OBP2A (untagged)-Human odorant binding protein 2A (OBP2A)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: OBP2A
• Synonyms: hOBPIIa; LCN13; OBP; OBP2C; OBPIIa
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_014582 edited
  CCGAGGTCGGCAGCACAGAGCTCTGGAGATGAAGACCCTGTTCCTGGGTGTCACGCTCGG
  CCTGGCCGCTGCCCTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTACGT
  GAAGGCCATGGTGGTCGATAAGGACTTTCCGGAGGACAGGAGGCCCAGGAAGGTGTCCCC
  AGTGAAGGTGACAGCCCTGGGCGGTGGGAACTTGGAAGCCACGTTCACCTTCATGAGGGA
  GGATCGGTGCATCCAGAAGAAAATCCTGATGCGGAAGACGGAGGAGCCTGGCAAATTCAG
  CGCCTATGGGGGCAGGAAGCTCATATACCTGCAGGAGCTGCCCGGGACGGACGACTACGT
  CTTTTACTGCAAAGACCAGCGCCGTGGGGGCCTGCGCTACATGGGAAAGCTTGTGGGTAG
  GAATCCTAATACCAACCTGGAGGCCCTGGAAGAATTTAAGAAATTGGTGCAGCACAAGGG
  ACTCTCGGAGGAGGACATTTTCATGCCCCTGCAGACGGGAAGCTGCGTTCTCGAACACTA
  GGCAGCCCCCGGGTCTGCACCTCCAGAGCCCACCCTACCACCAGACACAGA
  
• Restriction Sites: Please inquire
• ACCN: NM_014582
• ORF Size: 513 bp
• Insert Size: 600
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_014582.1, NP_055397.1
• RefSeq Size: 676
• RefSeq ORF: 513
• Locus ID: 29991
• Protein Families: Secreted Protein
• Gene Summary: This gene encodes a small extracellular protein belonging to the lipocalin superfamily. The protein is thought to transport small, hydrophobic, volatile molecules or odorants through the nasal mucus to olfactory receptors, and may also function as a scavenger of highly concentrated or toxic odors. The protein is expressed as a monomer in the nasal mucus, and can bind diverse types of odorants with a higher affinity for aldehydes and fatty acids. This gene and a highly similar family member are located in a cluster of lipocalin genes on chromosome 9. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (alpha, PMID:10607840) uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant gamma. It encodes isoform alpha, which has a shorter and distinct C-terminus, compared to isoform gamma.