KChIP2 (KCNIP2) (NM_014591) Human Untagged Clone
CAT#: SC304137
KCNIP2 (untagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1
"NM_014591" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KCNIP2 |
Synonyms | KCHIP2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_014591 edited
ATGCGGGGCCAGGGCCGCAAGGAGAGTTTGTCCGATTCCCGAGACCTGGACGGCTCCTAC GACCAGCTCACGGGCCACCCTCCAGGGCCCACTAAAAAAGCGCTGAAGCAGCGATTCCTC AAGCTGCTGCCGTGCTGCGGGCCCCAAGCCCTGCCCTCAGTCAGTGAAATTGGCCGGGTC TTCCGCTTTCTCGGTGACAGTTCGCTCCCTTCAGCATTAGCCGCCCCAGCCTCCCTCCGC CCCCACAGACCCCGCCTGCTGGACCCAGACAGCGTGGACGATGAATTTGAATTGTCCACC GTGTGTCACCGGCCTGAGGGTCTGGAGCAGCTGCAGGAGCAAACCAAATTCACGCGCAAG GAGTTGCAGGTCCTGTACCGGGGCTTCAAGAACGAATGTCCCAGCGGAATTGTCAATGAG GAGAACTTCAAGCAGATTTACTCCCAGTTCTTTCCTCAAGGAGACTCCAGCACCTATGCC ACTTTTCTCTTCAATGCCTTTGACACCAACCATGATGGCTCGGTCAGTTTTGAGGACTTT GTGGCTGGTTTGTCCGTGATTCTTCGGGGAACTGTAGATGACAGGCTTAATTGGGCCTTC AACCTGTATGACCTTAACAAGGACGGCTGCATCACCAAGGAGGAAATGCTTGACATCATG AAGTCCATCTATGACATGATGGGCAAGTACACGTACCCTGCACTCCGGGAGGAGGCCCCA AGGGAACACGTGGAGAGCTTCTTCCAGAAGATGGACAGAAACAAGGATGGTGTGGTGACC ATTGAGGAATTCATTGAGTCTTGTCAAAAGGATGAGAACATCATGAGGTCCATGCAGCTC TTTGACAATGTCATCTAG |
Restriction Sites | Please inquire |
ACCN | NM_014591 |
ORF Size | 858 bp |
Insert Size | 900 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_014591.4, NP_055406.2 |
RefSeq Size | 2608 |
RefSeq ORF | 858 |
Locus ID | 30819 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the family of voltage-gated potassium (Kv) channel-interacting proteins (KCNIPs), which belongs to the recoverin branch of the EF-hand superfamily. Members of the KCNIP family are small calcium binding proteins. They all have EF-hand-like domains, and differ from each other in the N-terminus. They are integral subunit components of native Kv4 channel complexes. They may regulate A-type currents, and hence neuronal excitability, in response to changes in intracellular calcium. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified from this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), also known as KChIP4.2, encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213131 | KCNIP2 (Myc-DDK-tagged)-Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1 |
USD 420.00 |
|
RG213131 | KCNIP2 (GFP-tagged) - Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1 |
USD 460.00 |
|
RC213131L1 | Lenti ORF clone of Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC213131L2 | Lenti ORF clone of Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC213131L3 | Lenti ORF clone of Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC213131L4 | Lenti ORF clone of Human Kv channel interacting protein 2 (KCNIP2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review