Glutaredoxin 2 (GLRX2) (NM_016066) Human Untagged Clone
CAT#: SC304378
GLRX2 (untagged)-Human glutaredoxin 2 (GLRX2), transcript variant 1
"NM_016066" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GLRX2 |
Synonyms | CGI-133; GRX2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_016066, the custom clone sequence may differ by one or more nucleotides
ATGAACCCTCGAGATAAGCAAGTGAGCCGCTTCTCCCCTCTAAAGGATGTTTACACGTGGGTGGCACTCG CTGGAATCCAGCGCTCGGGCAGCCCTGGGAGGACGCGCTCAGCTGCGAGGAGGATGGAGAGCAATACATC ATCATCTTTGGAGAATTTAGCGACGGCGCCTGTGAACCAGATCCAAGAAACAATTTCTGATAATTGTGTG GTGATTTTCTCAAAAACATCCTGTTCTTACTGTACAATGGCAAAAAAGCTTTTCCATGACATGAATGTTA ACTATAAAGTGGTGGAACTGGACCTGCTTGAATATGGAAACCAGTTCCAAGATGCTCTTTACAAAATGAC TGGTGAAAGAACTGTTCCAAGAATATTTGTCAATGGTACTTTTATTGGAGGTGCAACTGACACTCATAGG CTTCACAAAGAAGGAAAATTGCTCCCACTAGTTCATCAGTGTTATTTAAAAAAAAGTAAGAGGAAAGAAT TTCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_016066 |
ORF Size | 498 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_016066.4, NP_057150.2 |
RefSeq Size | 1134 |
RefSeq ORF | 498 |
Locus ID | 51022 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as Grx2b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215566 | GLRX2 (Myc-DDK-tagged)-Human glutaredoxin 2 (GLRX2), transcript variant 1 |
USD 98.00 |
|
RG215566 | GLRX2 (GFP-tagged) - Human glutaredoxin 2 (GLRX2), transcript variant 1 |
USD 460.00 |
|
RC215566L1 | Lenti ORF clone of Human glutaredoxin 2 (GLRX2), transcript variant 1, Myc-DDK-tagged |
USD 768.00 |
|
RC215566L2 | Lenti ORF clone of Human glutaredoxin 2 (GLRX2), transcript variant 1, mGFP tagged |
USD 620.00 |
|
RC215566L3 | Lenti ORF clone of Human glutaredoxin 2 (GLRX2), transcript variant 1, Myc-DDK-tagged |
USD 620.00 |
|
RC215566L4 | Lenti ORF clone of Human glutaredoxin 2 (GLRX2), transcript variant 1, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review