Glutaredoxin 2 (GLRX2) (NM_016066) Human Untagged Clone

CAT#: SC304378

GLRX2 (untagged)-Human glutaredoxin 2 (GLRX2), transcript variant 1


  "NM_016066" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GLRX2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GLRX2
Synonyms CGI-133; GRX2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016066, the custom clone sequence may differ by one or more nucleotides


ATGAACCCTCGAGATAAGCAAGTGAGCCGCTTCTCCCCTCTAAAGGATGTTTACACGTGGGTGGCACTCG
CTGGAATCCAGCGCTCGGGCAGCCCTGGGAGGACGCGCTCAGCTGCGAGGAGGATGGAGAGCAATACATC
ATCATCTTTGGAGAATTTAGCGACGGCGCCTGTGAACCAGATCCAAGAAACAATTTCTGATAATTGTGTG
GTGATTTTCTCAAAAACATCCTGTTCTTACTGTACAATGGCAAAAAAGCTTTTCCATGACATGAATGTTA
ACTATAAAGTGGTGGAACTGGACCTGCTTGAATATGGAAACCAGTTCCAAGATGCTCTTTACAAAATGAC
TGGTGAAAGAACTGTTCCAAGAATATTTGTCAATGGTACTTTTATTGGAGGTGCAACTGACACTCATAGG
CTTCACAAAGAAGGAAAATTGCTCCCACTAGTTCATCAGTGTTATTTAAAAAAAAGTAAGAGGAAAGAAT
TTCAGTGA


Restriction Sites SgfI-MluI     
ACCN NM_016066
ORF Size 498 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_016066.4, NP_057150.2
RefSeq Size 1134
RefSeq ORF 498
Locus ID 51022
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1, also known as Grx2b).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.