WNT16 (NM_016087) Human Untagged Clone

CAT#: SC304380

WNT16 (untagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2


  "NM_016087" in other vectors (6)

Reconstitution Protocol

USD 600.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "WNT16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WNT16
Synonyms wingless-related MMTV integration site 16; wingless-type MMTV integration site family, member 16
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_016087 edited
CCATGCAGCTCACCACTTGCCTCAGGGAGACCCTCTTCACAGGGGCTTCTCAAAAGACCT
CCCTATGGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTGCGCCAATT
TGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCA
TCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGAT
GGAACTGCATGATCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTG
GCTACGAGCTGAGCAGCGGCACCAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAG
GCCTGGTGCATTCTGTGACCAGGTCATGCAGTGCAGGCAACATGACAGAGTGTTCCTGTG
ACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAAGGCTGGCACTGGGGGGGCTGCTCCG
ATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGATTTCCCCATCGGAAACA
CCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAAGCTGGAA
GGCAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCT
GTGCTGTGAAAACATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGA
AGGATAAATATGAAAACAGTATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGA
GAGAAAAAGATCAGAGGAAAATACCAATCCATAAGGATGATCTGCTCTATGTTAATAAGT
CTCCCAACTACTGTGTAGAAGATAAGAAACTGGGAATCCCAGGGACACAAGGCAGAGAAT
GCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTCCTCTGCTGTGGCCGAGGTTACA
ACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATCTGGTGCTGCTATG
TCCGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAAC
Restriction Sites Please inquire     
ACCN NM_016087
ORF Size 1068 bp
Insert Size 1100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_016087.2.
Reference Data
RefSeq NM_016087.2, NP_057171.2
RefSeq Size 2894
RefSeq ORF 1068
Locus ID 51384
Protein Families Secreted Protein, Transmembrane
Protein Pathways Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway
Gene Summary The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs from variant 1 at the 5' terminus including 5' UTR and the coding region for the N-terminus. It encodes a shorter isoform than variant 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.