WNT16 (NM_016087) Human Untagged Clone
CAT#: SC304380
WNT16 (untagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2
"NM_016087" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | WNT16 |
Synonyms | wingless-related MMTV integration site 16; wingless-type MMTV integration site family, member 16 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_016087 edited
CCATGCAGCTCACCACTTGCCTCAGGGAGACCCTCTTCACAGGGGCTTCTCAAAAGACCT CCCTATGGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTGCGCCAATT TGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCA TCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGAT GGAACTGCATGATCACCGCCGCCGCCACTACCGCCCCGATGGGCGCCAGCCCCCTCTTTG GCTACGAGCTGAGCAGCGGCACCAAAGAGACAGCATTTATTTATGCTGTGATGGCTGCAG GCCTGGTGCATTCTGTGACCAGGTCATGCAGTGCAGGCAACATGACAGAGTGTTCCTGTG ACACCACCTTGCAGAACGGCGGCTCAGCAAGTGAAGGCTGGCACTGGGGGGGCTGCTCCG ATGATGTCCAGTATGGCATGTGGTTCAGCAGAAAGTTCCTAGATTTCCCCATCGGAAACA CCACGGGCAAAGAAAACAAAGTACTATTAGCAATGAACCTACATAACAATGAAGCTGGAA GGCAGGCTGTCGCCAAGTTGATGTCAGTAGACTGCCGCTGCCACGGAGTTTCCGGCTCCT GTGCTGTGAAAACATGCTGGAAAACCATGTCTTCTTTTGAAAAGATTGGCCATTTGTTGA AGGATAAATATGAAAACAGTATCCAGATATCAGACAAAACAAAGAGGAAAATGCGCAGGA GAGAAAAAGATCAGAGGAAAATACCAATCCATAAGGATGATCTGCTCTATGTTAATAAGT CTCCCAACTACTGTGTAGAAGATAAGAAACTGGGAATCCCAGGGACACAAGGCAGAGAAT GCAACCGTACATCAGAGGGTGCAGATGGCTGCAACCTCCTCTGCTGTGGCCGAGGTTACA ACACCCATGTGGTCAGGCACGTGGAGAGGTGTGAGTGTAAGTTCATCTGGTGCTGCTATG TCCGTTGCAGGAGGTGTGAAAGCATGACTGATGTCCACACTTGCAAGTAAC |
Restriction Sites | Please inquire |
ACCN | NM_016087 |
ORF Size | 1068 bp |
Insert Size | 1100 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_016087.2. |
Reference Data | |
RefSeq | NM_016087.2, NP_057171.2 |
RefSeq Size | 2894 |
RefSeq ORF | 1068 |
Locus ID | 51384 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Basal cell carcinoma, Hedgehog signaling pathway, Melanogenesis, Pathways in cancer, Wnt signaling pathway |
Gene Summary | The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It contains two transcript variants diverging at the 5' termini. These two variants are proposed to be the products of separate promoters and not to be splice variants from a single promoter. They are differentially expressed in normal tissues, one of which (variant 2) is expressed at significant levels only in the pancreas, whereas another one (variant 1) is expressed more ubiquitously with highest levels in adult kidney, placenta, brain, heart, and spleen. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs from variant 1 at the 5' terminus including 5' UTR and the coding region for the N-terminus. It encodes a shorter isoform than variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222372 | WNT16 (Myc-DDK-tagged)-Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2 |
USD 420.00 |
|
RG222372 | WNT16 (GFP-tagged) - Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2 |
USD 460.00 |
|
RC222372L1 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, Myc-DDK-tagged |
USD 768.00 |
|
RC222372L2 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, mGFP tagged |
USD 620.00 |
|
RC222372L3 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC222372L4 | Lenti ORF clone of Human wingless-type MMTV integration site family, member 16 (WNT16), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review