TAS2R16 (NM_016945) Human Untagged Clone

CAT#: SC304456

TAS2R16 (untagged)-Human taste receptor, type 2, member 16 (TAS2R16)


  "NM_016945" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAS2R16"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAS2R16
Synonyms BGLPT; T2R16
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_016945, the custom clone sequence may differ by one or more nucleotides


ATGATACCCATCCAACTCACTGTCTTCTTCATGATCATCTATGTGCTTGAGTCCTTGACAATTATTGTGC
AGAGCAGCCTAATTGTTGCAGTGCTGGGCAGAGAATGGCTGCAAGTCAGAAGGCTGATGCCTGTGGACAT
GATTCTCATCAGCCTGGGCATCTCTCGCTTCTGTCTACAGTGGGCATCAATGCTGAACAATTTTTGCTCC
TATTTTAATTTGAATTATGTACTTTGCAACTTAACAATCACCTGGGAATTTTTTAATATCCTTACATTCT
GGTTAAACAGCTTGCTTACCGTGTTCTACTGCATCAAGGTCTCTTCTTTCACCCATCACATCTTTCTCTG
GCTGAGGTGGAGAATTTTGAGGTTGTTTCCCTGGATATTACTGGGTTCTCTGATGATTACTTGTGTAACA
ATCATCCCTTCAGCTATTGGGAATTACATTCAAATTCAGTTACTCACCATGGAGCATCTACCAAGAAACA
GCACTGTAACTGACAAACTTGAAAATTTTCATCAGTATCAGTTCCAGGCTCATACAGTTGCATTGGTTAT
TCCTTTCATCCTGTTCCTGGCCTCCACCATCTTTCTCATGGCATCACTGACCAAGCAGATACAACATCAT
AGCACTGGTCACTGCAATCCAAGCATGAAAGCGCGCTTCACTGCCCTGAGGTCCCTTGCCGTCTTATTTA
TTGTGTTTACCTCTTACTTTCTAACCATACTCATCACCATTATAGGTACTCTATTTGATAAGAGATGTTG
GTTATGGGTCTGGGAAGCTTTTGTCTATGCTTTCATCTTAATGCATTCCACTTCACTGATGCTGAGCAGC
CCTACGTTGAAAAGGATTCTAAAGGGAAAGTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_016945
ORF Size 876 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_016945.2, NP_058641.1
RefSeq Size 996
RefSeq ORF 876
Locus ID 50833
Protein Families Druggable Genome, Transmembrane
Protein Pathways Taste transduction
Gene Summary This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily. These family members are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.