IL26 (NM_018402) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IL26 |
Synonyms | AK155; IL-26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_018402, the custom clone sequence may differ by one or more nucleotides
ATGCTGGTGAATTTCATTTTGAGGTGTGGGTTGCTGTTAGTCACTCTGTCTCTTGCCATTGCCAAGCACA AGCAATCTTCCTTCACCAAAAGTTGTTACCCAAGGGGAACATTGTCCCAAGCTGTTGACGCTCTCTATAT CAAAGCAGCATGGCTCAAAGCAACGATTCCAGAAGACCGCATAAAAAATATACGATTATTAAAAAAGAAA ACAAAAAAGCAGTTTATGAAAAACTGTCAATTTCAAGAACAGCTTCTGTCCTTCTTCATGGAAGACGTTT TTGGTCAACTGCAATTGCAAGGCTGCAAGAAAATACGCTTTGTGGAGGACTTTCATAGCCTTAGGCAGAA ATTGAGCCACTGTATTTCCTGTGCTTCATCAGCTAGAGAGATGAAATCCATTACCAGGATGAAAAGAATA TTTTATAGGATTGGAAACAAAGGAATCTACAAAGCCATCAGTGAACTGGATATTCTTCTTTCCTGGATTA AAAAATTATTGGAAAGCAGTCAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_018402 |
ORF Size | 516 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_018402.1, NP_060872.1 |
RefSeq Size | 1047 |
RefSeq ORF | 516 |
Locus ID | 55801 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | This gene was identified by its overexpression specifically in herpesvirus samimiri-transformed T cells. The encoded protein is a member of the IL10 family of cytokines. It is a secreted protein and may function as a homodimer. This protein is thought to contribute to the transformed phenotype of T cells after infection by herpesvirus samimiri. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215491 | IL26 (Myc-DDK-tagged)-Human interleukin 26 (IL26) |
USD 98.00 |
|
RG215491 | IL26 (GFP-tagged) - Human interleukin 26 (IL26) |
USD 460.00 |
|
RC215491L3 | Lenti ORF clone of Human interleukin 26 (IL26), Myc-DDK-tagged |
USD 620.00 |
|
RC215491L4 | Lenti ORF clone of Human interleukin 26 (IL26), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review