YOD1 (NM_018566) Human Untagged Clone
CAT#: SC304609
YOD1 (untagged)-Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1)
"NM_018566" in other vectors (6)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | YOD1 |
Synonyms | DUBA8; OTUD2; PRO0907 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_018566, the custom clone sequence may differ by one or more nucleotides
ATGTTTGGCCCCGCTAAAGGTCGCCATTTTGGAGTCCACCCGGCGCCTGGTTTCCCCGGCGGCGTCTCCC AACAGGCTGCCGGGACCAAAGCTGGCCCCGCGGGTGCCTGGCCTGTGGGCAGCCGGACCGACACGATGTG GCGGCTCCGCTGCAAGGCCAAGGACGGCACCCATGTTTTGCAGGGGCTGTCCAGCCGGACCCGGGTGCGG GAACTCCAGGGCCAAATTGCCGCCATCACCGGGATCGCCCCCGGCGGTCAGCGAATCCTCGTCGGATACC CTCCCGAGTGCCTGGATCTCAGCAATGGGGATACCATTCTGGAAGACTTGCCCATCCAATCTGGTGACAT GCTGATCATTGAAGAAGACCAAACCAGGCCCAGAAGTTCACCTGCATTTACTAAACGTGGTGCTTCTAGT TACGTCAGGGAAACTTTGCCTGTGCTTACCAGAACCGTGGTCCCAGCAGACAACTCTTGCCTCTTTACTA GTGTGTACTATGTCGTCGAAGGAGGAGTCTTGAATCCAGCTTGTGCCCCTGAGATGAGACGCCTCATAGC ACAAATTGTAGCAAGCGATCCAGACTTCTATAGTGAGGCAATACTGGGAAAAACAAATCAAGAGTACTGT GACTGGATCAAAAGGGATGACACTTGGGGAGGAGCAATAGAGATATCGATTTTGTCCAAGTTTTACCAAT GTGAAATATGTGTAGTGGATACACAGACAGTAAGAATTGATCGTTTTGGGGAAGATGCAGGATATACCAA AAGGGTTCTGCTTATTTATGATGGCATCCACTATGATCCACTTCAGCGTAACTTCCCTGATCCAGATACA CCTCCTCTGACCATTTTCTCCTCTAATGATGATATTGTTCTTGTACAAGCACTGGAATTAGCAGATGAAG CTAGAAGAAGGAGACAGTTTACTGATGTCAACCGCTTCACCCTGAGATGCATGGTATGTCAGAAAGGATT AACTGGACAAGCAGAAGCAAGGGAACATGCCAAGGAGACAGGCCATACCAACTTTGGAGAAGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_018566 |
ORF Size | 1047 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_018566.3, NP_061036.3 |
RefSeq Size | 6265 |
RefSeq ORF | 1047 |
Locus ID | 55432 |
Protein Pathways | Biosynthesis of unsaturated fatty acids, Limonene and pinene degradation |
Gene Summary | Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212788 | YOD1 (Myc-DDK-tagged)-Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1) |
USD 420.00 |
|
RG212788 | YOD1 (GFP-tagged) - Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1) |
USD 460.00 |
|
RC212788L1 | Lenti ORF clone of Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1), Myc-DDK-tagged |
USD 620.00 |
|
RC212788L2 | Lenti ORF clone of Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1), mGFP tagged |
USD 620.00 |
|
RC212788L3 | Lenti ORF clone of Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1), Myc-DDK-tagged |
USD 620.00 |
|
RC212788L4 | Lenti ORF clone of Human YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae) (YOD1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review