TAS2R5 (NM_018980) Human Untagged Clone
CAT#: SC304645
TAS2R5 (untagged)-Human taste receptor, type 2, member 5 (TAS2R5)
"NM_018980" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAS2R5 |
Synonyms | T2R5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_018980, the custom clone sequence may differ by one or more nucleotides
ATGCTGAGCGCTGGCCTAGGACTGCTGATGCTGGTGGCAGTGGTTGAATTTCTCATCGGTTTAATTGGAA ATGGAAGCCTGGTGGTCTGGAGTTTTAGAGAATGGATCAGAAAATTCAACTGGTCCTCATATAACCTCAT TATCCTGGGCCTGGCTGGCTGCCGATTTCTCCTGCAGTGGCTGATCATTTTGGACTTAAGCTTGTTTCCA CTTTTCCAGAGCAGCCGTTGGCTTCGCTATCTTAGTATCTTCTGGGTCCTGGTAAGCCAGGCCAGCTTAT GGTTTGCCACCTTCCTCAGTGTCTTCTATTGCAAGAAGATCACGACCTTCGATCGCCCGGCCTACTTGTG GCTGAAGCAGAGGGCCTATAACCTGAGTCTCTGGTGCCTTCTGGGCTACTTTATAATCAATTTGTTACTT ACAGTCCAAATTGGCTTAACATTCTATCATCCTCCCCAAGGAAACAGCAGCATTCGGTATCCCTTTGAAA GCTGGCAGTACCTGTATGCATTTCAGCTCAATTCAGGAAGTTATTTGCCTTTAGTGGTGTTTCTTGTTTC CTCTGGGATGCTGATTGTCTCTTTGTATACACACCACAAGAAGATGAAGGTCCATTCAGCTGGTAGGAGG GATGTCCGGGCCAAGGCTCACATCACTGCGCTGAAGTCCTTGGGCTGCTTCCTCTTACTTCACCTGGTTT ATATCATGGCCAGCCCCTTCTCCATCACCTCCAAGACTTATCCTCCTGATCTCACCAGTGTCTTCATCTG GGAGACACTCATGGCAGCCTATCCTTCTCTTCATTCTCTCATATTGATCATGGGGATTCCTAGGGTGAAG CAGACTTGTCAGAAGATCCTGTGGAAGACAGTGTGTGCTCGGAGATGCTGGGGCCCATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_018980 |
ORF Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_018980.2, NP_061853.1 |
RefSeq Size | 1150 |
RefSeq ORF | 900 |
Locus ID | 54429 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Taste transduction |
Gene Summary | This gene encodes a bitter taste receptor; bitter taste receptors are members of the G protein-coupled receptor superfamily and are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless taste receptor genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes on chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220188 | TAS2R5 (Myc-DDK-tagged)-Human taste receptor, type 2, member 5 (TAS2R5) |
USD 420.00 |
|
RG220188 | TAS2R5 (GFP-tagged) - Human taste receptor, type 2, member 5 (TAS2R5) |
USD 460.00 |
|
RC220188L3 | Lenti ORF clone of Human taste receptor, type 2, member 5 (TAS2R5), Myc-DDK-tagged |
USD 620.00 |
|
RC220188L4 | Lenti ORF clone of Human taste receptor, type 2, member 5 (TAS2R5), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review