TAS2R5 (NM_018980) Human Untagged Clone

CAT#: SC304645

TAS2R5 (untagged)-Human taste receptor, type 2, member 5 (TAS2R5)


  "NM_018980" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAS2R5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAS2R5
Synonyms T2R5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_018980, the custom clone sequence may differ by one or more nucleotides


ATGCTGAGCGCTGGCCTAGGACTGCTGATGCTGGTGGCAGTGGTTGAATTTCTCATCGGTTTAATTGGAA
ATGGAAGCCTGGTGGTCTGGAGTTTTAGAGAATGGATCAGAAAATTCAACTGGTCCTCATATAACCTCAT
TATCCTGGGCCTGGCTGGCTGCCGATTTCTCCTGCAGTGGCTGATCATTTTGGACTTAAGCTTGTTTCCA
CTTTTCCAGAGCAGCCGTTGGCTTCGCTATCTTAGTATCTTCTGGGTCCTGGTAAGCCAGGCCAGCTTAT
GGTTTGCCACCTTCCTCAGTGTCTTCTATTGCAAGAAGATCACGACCTTCGATCGCCCGGCCTACTTGTG
GCTGAAGCAGAGGGCCTATAACCTGAGTCTCTGGTGCCTTCTGGGCTACTTTATAATCAATTTGTTACTT
ACAGTCCAAATTGGCTTAACATTCTATCATCCTCCCCAAGGAAACAGCAGCATTCGGTATCCCTTTGAAA
GCTGGCAGTACCTGTATGCATTTCAGCTCAATTCAGGAAGTTATTTGCCTTTAGTGGTGTTTCTTGTTTC
CTCTGGGATGCTGATTGTCTCTTTGTATACACACCACAAGAAGATGAAGGTCCATTCAGCTGGTAGGAGG
GATGTCCGGGCCAAGGCTCACATCACTGCGCTGAAGTCCTTGGGCTGCTTCCTCTTACTTCACCTGGTTT
ATATCATGGCCAGCCCCTTCTCCATCACCTCCAAGACTTATCCTCCTGATCTCACCAGTGTCTTCATCTG
GGAGACACTCATGGCAGCCTATCCTTCTCTTCATTCTCTCATATTGATCATGGGGATTCCTAGGGTGAAG
CAGACTTGTCAGAAGATCCTGTGGAAGACAGTGTGTGCTCGGAGATGCTGGGGCCCATGA


Restriction Sites SgfI-MluI     
ACCN NM_018980
ORF Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_018980.2, NP_061853.1
RefSeq Size 1150
RefSeq ORF 900
Locus ID 54429
Protein Families Druggable Genome, Transmembrane
Protein Pathways Taste transduction
Gene Summary This gene encodes a bitter taste receptor; bitter taste receptors are members of the G protein-coupled receptor superfamily and are specifically expressed by taste receptor cells of the tongue and palate epithelia. Each of these apparently intronless taste receptor genes encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes on chromosome 7 and is genetically linked to loci that influence bitter perception. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.