ABO (NM_020469) Human Untagged Clone

CAT#: SC304773

ABO (untagged)-Human ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase) (ABO)


  "NM_020469" in other vectors (6)

Reconstitution Protocol

USD 600.00

3 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ABO
Synonyms A3GALNT; A3GALT1; GTB; NAGAT
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_020469, the custom clone sequence may differ by one or more nucleotides


ATGGCCGAGGTGTTGCGGACGCTGGCCGGAAAACCAAAATGCCACGCACTTCGACCTATGATCCTTTTCC
TAATAATGCTTGTCTTGGTCTTGTTTGGTTACGGGGTCCTAAGCCCCAGAAGTCTAATGCCAGGAAGCCT
GGAACGGGGGTTCTGCATGGCTGTTAGGGAACCTGACCATCTGCAGCGCGTCTCGTTGCCAAGGATGGTC
TACCCCCAGCCAAAGGTGCTGACACCGTGTAGGAAGGATGTCCTCGTGGTGACCCCTTGGCTGGCTCCCA
TTGTCTGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAGTTCAGGCTCCAGAACACCACCATTGG
GTTAACTGTGTTTGCCATCAAGAAATACGTGGCTTTCCTGAAGCTGTTCCTGGAGACGGCGGAGAAGCAC
TTCATGGTGGGCCACCGTGTCCACTACTATGTCTTCACCGACCAGCCGGCCGCGGTGCCCCGCGTGACGC
TGGGGACCGGTCGGCAGCTGTCAGTGCTGGAGGTGCGCGCCTACAAGCGCTGGCAGGACGTGTCCATGCG
CCGCATGGAGATGATCAGTGACTTCTGCGAGCGGCGCTTCCTCAGCGAGGTGGATTACCTGGTGTGCGTG
GACGTGGACATGGAGTTCCGCGACCACGTGGGCGTGGAGATCCTGACTCCGCTGTTCGGCACCCTGCACC
CCGGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGCCGGCCCCAGTCCCAGGCCTACATCCC
CAAGGACGAGGGCGATTTCTACTACCTGGGGGGGTTCTTCGGGGGGTCGGTGCAAGAGGTGCAGCGGCTC
ACCAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGGCATCGAGGCCGTGTGGCACGACGAGA
GCCACCTGAACAAGTACCTGCTGCGCCACAAACCCACCAAGGTGCTCTCCCCCGAGTACTTGTGGGACCA
GCAGCTGCTGGGCTGGCCCGCCGTCCTGAGGAAGCTGAGGTTCACTGCGGTGCCCAAGAACCACCAGGCG
GTCCGGAACCCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_020469
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_020469.2, NP_065202.2
RefSeq Size 1580 bp
RefSeq ORF 1065 bp
Locus ID 28
Cytogenetics 9q34.2
Protein Families Secreted Protein, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary 'This gene encodes proteins related to the first discovered blood group system, ABO. Variation in the ABO gene (chromosome 9q34.2) is the basis of the ABO blood group, thus the presence of an allele determines the blood group in an individual. The 'O' blood group is caused by a deletion of guanine-258 near the N-terminus of the protein which results in a frameshift and translation of an almost entirely different protein. Individuals with the A, B, and AB alleles express glycosyltransferase activities that convert the H antigen into the A or B antigen. Other minor alleles have been found for this gene. This locus has been identified as a susceptibility locus for severe coronavirus disease 2019 (COVID-19) by genome-wide association study. [provided by RefSeq, Aug 2020]'

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.