B3GALT1 (NM_020981) Human Untagged Clone

CAT#: SC304882

B3GALT1 (untagged)-Human UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1 (B3GALT1)


  "NM_020981" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "B3GALT1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol B3GALT1
Synonyms beta3Gal-T1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_020981, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCAAAGGTCTCCTGTTTGTATGTTTTGACAGTTGTGTGCTGGGCCAGCGCTCTCTGGTACTTGA
GTATAACTCGCCCTACTTCTTCTTACACTGGCTCCAAACCATTCAGCCACCTAACAGTTGCCAGGAAAAA
CTTCACCTTTGGCAACATAAGAACTCGACCTATCAACCCACATTCTTTTGAATTTCTTATCAACGAGCCC
AATAAATGTGAGAAAAACATTCCTTTTCTTGTTATCCTCATCAGCACCACTCACAAGGAATTTGATGCCC
GTCAGGCAATCAGAGAGACGTGGGGGGATGAGAACAACTTTAAGGGGATCAAGATAGCCACCCTGTTCCT
CCTGGGCAAGAATGCTGATCCTGTTCTCAATCAGATGGTGGAGCAAGAGAGCCAAATCTTCCATGATATC
ATCGTGGAGGACTTTATTGACTCCTACCATAACCTTACCCTCAAAACATTAATGGGGATGAGATGGGTGG
CCACTTTTTGTTCAAAAGCCAAGTATGTCATGAAAACAGACAGCGACATTTTTGTAAACATGGACAATCT
TATTTATAAATTACTGAAACCCTCCACCAAGCCACGAAGAAGGTATTTTACTGGCTATGTCATTAATGGA
GGACCGATTCGGGATGTCCGCAGTAAGTGGTATATGCCCAGGGATTTGTACCCAGACAGTAACTACCCAC
CTTTCTGTTCGGGGACTGGCTACATCTTTTCAGCCGATGTAGCTGAACTCATTTACAAGACCTCACTCCA
CACAAGGCTGCTTCACCTTGAAGACGTATATGTGGGACTGTGTCTTCGAAAGCTGGGCATACATCCTTTC
CAGAACAGTGGCTTCAATCACTGGAAAATGGCCTACAGTTTGTGTAGGTATCGCCGAGTTATCACTGTGC
ATCAGATCTCTCCAGAAGAAATGCACAGAATCTGGAATGACATGTCAAGCAAGAAACATCTCAGATGTTA
G


Restriction Sites SgfI-MluI     
ACCN NM_020981
ORF Size 981 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_020981.3, NP_066191.1
RefSeq Size 2168
RefSeq ORF 981
Locus ID 8708
Protein Families Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is expressed exclusively in the brain. The encoded protein shows strict donor substrate specificity for UDP-galactose. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.