HIST2H3C (NM_021059) Human Untagged Clone

CAT#: SC304901

HIST2H3C (untagged)-Human histone cluster 2, H3c (HIST2H3C)


  "NM_021059" in other vectors (6)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "HIST2H3C"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HIST2H3C
Synonyms H3; H3.2; H3/M; H3F2; H3FM; H3FN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021059, the custom clone sequence may differ by one or more nucleotides


ATGGCCCGTACTAAGCAGACTGCTCGCAAGTCGACCGGCGGCAAGGCCCCGAGGAAGCAGCTGGCCACCA
AGGCGGCCCGCAAGAGCGCGCCGGCCACGGGCGGGGTGAAGAAGCCGCACCGCTACCGGCCCGGCACCGT
AGCCCTGCGGGAGATCCGGCGCTACCAGAAGTCCACGGAGCTGCTGATCCGCAAGCTGCCCTTCCAGCGG
CTGGTACGCGAGATCGCGCAGGACTTTAAGACGGACCTGCGCTTCCAGAGCTCGGCCGTGATGGCGCTGC
AGGAGGCCAGCGAGGCCTACCTGGTGGGGCTGTTCGAAGACACGAACCTGTGCGCCATCCACGCCAAGCG
CGTGACCATTATGCCCAAGGACATCCAGCTGGCCCGCCGCATCCGTGGAGAGCGGGCTTAA


Restriction Sites SgfI-MluI     
ACCN NM_021059
ORF Size 411 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_021059.2, NP_066403.2
RefSeq Size 507
RefSeq ORF 411
Locus ID 126961
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H3 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the telomeric copy. [provided by RefSeq, Aug 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.