TGF beta induced factor 2 (TGIF2) (NM_021809) Human Untagged Clone

CAT#: SC304959

TGIF2 (untagged)-Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2


  "NM_021809" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TGIF2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TGIF2
Synonyms TGFB-induced factor 2; TGFB-induced factor homeobox 2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021809, the custom clone sequence may differ by one or more nucleotides


ATGTCGGACAGTGATCTAGGTGAGGACGAAGGCCTCCTCTCCCTGGCGGGCAAAAGGAAGCGCAGGGGGA
ACCTGCCCAAGGAGTCGGTGAAGATCCTCCGGGACTGGCTGTACTTGCACCGCTACAACGCCTACCCCTC
AGAGCAGGAGAAGCTGAGCCTTTCTGGACAGACCAACCTGTCAGTGCTGCAAATATGTAACTGGTTCATC
AATGCCCGGCGGCGGCTTCTCCCAGACATGCTTCGGAAGGATGGCAAAGACCCTAATCAGTTTACCATTT
CCCGCCGCGGGGGTAAGGCCTCAGATGTGGCCCTCCCCCGTGGCAGCAGCCCCTCAGTGCTGGCTGTGTC
TGTCCCAGCCCCCACCAATGTGCTCTCCCTGTCTGTGTGCTCCATGCCGCTTCACTCAGGCCAGGGGGAA
AAGCCAGCAGCCCCTTTCCCACGTGGGGAGCTGGAGTCTCCCAAGCCCCTGGTGACCCCTGGTAGCACAC
TTACTCTGCTGACCAGGGCTGAGGCTGGAAGCCCCACAGGTGGACTCTTCAACACGCCACCACCCACACC
CCCAGAGCAGGACAAAGAGGACTTCAGCAGCTTCCAGCTGCTGGTGGAGGTGGCGCTACAGAGGGCTGCT
GAGATGGAGCTTCAGAAGCAGCAGGACCCATCACTCCCATTACTGCACACTCCCATCCCTTTAGTCTCTG
AAAATCCCCAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_021809
ORF Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_021809.6, NP_068581.1
RefSeq Size 3415
RefSeq ORF 714
Locus ID 60436
Protein Families Transcription Factors
Gene Summary The protein encoded by this gene is a DNA-binding homeobox protein and a transcriptional repressor, which appears to repress transcription by recruiting histone deacetylases to TGF beta-responsive genes. This gene is amplified and over-expressed in some ovarian cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. Read-through transcription also exists between this gene and the neighboring downstream C20orf24 (chromosome 20 open reading frame 24) gene. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants (1-4) encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.