TGF beta induced factor 2 (TGIF2) (NM_021809) Human Untagged Clone
CAT#: SC304959
TGIF2 (untagged)-Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2
"NM_021809" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TGIF2 |
Synonyms | TGFB-induced factor 2; TGFB-induced factor homeobox 2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_021809, the custom clone sequence may differ by one or more nucleotides
ATGTCGGACAGTGATCTAGGTGAGGACGAAGGCCTCCTCTCCCTGGCGGGCAAAAGGAAGCGCAGGGGGA ACCTGCCCAAGGAGTCGGTGAAGATCCTCCGGGACTGGCTGTACTTGCACCGCTACAACGCCTACCCCTC AGAGCAGGAGAAGCTGAGCCTTTCTGGACAGACCAACCTGTCAGTGCTGCAAATATGTAACTGGTTCATC AATGCCCGGCGGCGGCTTCTCCCAGACATGCTTCGGAAGGATGGCAAAGACCCTAATCAGTTTACCATTT CCCGCCGCGGGGGTAAGGCCTCAGATGTGGCCCTCCCCCGTGGCAGCAGCCCCTCAGTGCTGGCTGTGTC TGTCCCAGCCCCCACCAATGTGCTCTCCCTGTCTGTGTGCTCCATGCCGCTTCACTCAGGCCAGGGGGAA AAGCCAGCAGCCCCTTTCCCACGTGGGGAGCTGGAGTCTCCCAAGCCCCTGGTGACCCCTGGTAGCACAC TTACTCTGCTGACCAGGGCTGAGGCTGGAAGCCCCACAGGTGGACTCTTCAACACGCCACCACCCACACC CCCAGAGCAGGACAAAGAGGACTTCAGCAGCTTCCAGCTGCTGGTGGAGGTGGCGCTACAGAGGGCTGCT GAGATGGAGCTTCAGAAGCAGCAGGACCCATCACTCCCATTACTGCACACTCCCATCCCTTTAGTCTCTG AAAATCCCCAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_021809 |
ORF Size | 714 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_021809.6, NP_068581.1 |
RefSeq Size | 3415 |
RefSeq ORF | 714 |
Locus ID | 60436 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a DNA-binding homeobox protein and a transcriptional repressor, which appears to repress transcription by recruiting histone deacetylases to TGF beta-responsive genes. This gene is amplified and over-expressed in some ovarian cancers. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. Read-through transcription also exists between this gene and the neighboring downstream C20orf24 (chromosome 20 open reading frame 24) gene. [provided by RefSeq, Dec 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. All variants (1-4) encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200773 | TGIF2 (Myc-DDK-tagged)-Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2 |
USD 98.00 |
|
RG200773 | TGIF2 (GFP-tagged) - Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2 |
USD 460.00 |
|
RC200773L3 | Lenti ORF clone of Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2, Myc-DDK-tagged |
USD 620.00 |
|
RC200773L4 | Lenti ORF clone of Human TGFB-induced factor homeobox 2 (TGIF2), transcript variant 2, mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review