TOR1AIP2 (NM_022347) Human Untagged Clone

CAT#: SC305015

TOR1AIP2 (untagged)-Human torsin A interacting protein 2 (TOR1AIP2), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TOR1AIP2
• Synonyms: IFRG15; LULL1; NET9
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_022347, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTTCAGATAATTCACATTGCCCTGATTGTGGACAACAGTGGTTCCCTAGTTTAGAACTAGGCCACT
  GGTTGTACCAAACTGAACTTGTTGAAAATGAATGTTACCAGGTATTCTTAGACCGTATTAACAGAGCTGA
  TTATTGTCCTGAGTGTTATCCTGATAATCCTGCTAATAGAAGCCTTGTTCTTCCTTGGTCTTTCCCACTT
  GAGTGGGCTCCCCAGAATCTCACCAGATGGACCTTTGAGAAAGCTTGCCATCCATTTCTTCTGGGTCCTC
  CACTGGTTAGAAAAAGAATACATGACTCTCGAGTAGCTGGTTTTAACCCTGCATTACAGTTAATCTTGAC
  CAGAACAGATAAAACCTTAAACAAAAAACTGGGCCAAAACAAATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_022347
• ORF Size: 396 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_022347.3, NP_071742.1
• RefSeq Size: 7074
• RefSeq ORF: 396
• Locus ID: 163590
• Protein Families: Transmembrane
• Gene Summary: One of the two protein isoforms encoded by this gene is a type II integral membrane protein found in the endoplasmic reticulum (ER). The encoded protein is a cofactor for the ATPase TorsinA, regulating the amount of TorsinA present in the ER compared to that found in the nuclear envelope. Defects in this protein are a cause of early onset primary dystonia, a neuromuscular disease. The other isoform encoded by this gene is an interferon alpha responsive protein whose cellular role has yet to be determined. [provided by RefSeq, Mar 2017]
  Transcript Variant: This variant (1) represents the shorter transcript and encodes isoform a, interferon alpha responsive protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.