TAS2R8 (NM_023918) Human Untagged Clone

CAT#: SC305080

TAS2R8 (untagged)-Human taste receptor, type 2, member 8 (TAS2R8)


  "NM_023918" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAS2R8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TAS2R8
Synonyms T2R8; TRB5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_023918, the custom clone sequence may differ by one or more nucleotides


ATGTTCAGTCCTGCAGATAACATCTTTATAATCCTAATAACTGGAGAATTCATACTAGGAATATTGGGGA
ATGGATACATTGCACTAGTCAACTGGATTGACTGGATTAAGAAGAAAAAGATTTCCACAGTTGACTACAT
CCTTACCAATTTAGTTATCGCCAGAATTTGTTTGATCAGTGTAATGGTTGTAAATGGCATTGTAATAGTA
CTGAACCCAGATGTTTATACAAAAAATAAACAACAGATAGTCATTTTTACCTTCTGGACATTTGCCAACT
ACTTAAATATGTGGATTACCACCTGCCTTAATGTCTTCTATTTTCTGAAGATAGCCAGTTCCTCTCATCC
ACTTTTTCTCTGGCTGAAGTGGAAAATTGATATGGTGGTGCACTGGATCCTGCTGGGATGCTTTGCCATT
TCCTTGTTGGTCAGCCTTATAGCAGCAATAGTACTGAGTTGTGATTATAGGTTTCATGCAATTGCCAAAC
ATAAAAGAAACATTACTGAAATGTTCCATGTGAGTAAAATACCATACTTTGAACCCTTGACTCTCTTTAA
CCTGTTTGCAATTGTCCCATTTATTGTGTCACTGATATCATTTTTCCTTTTAGTAAGATCTTTATGGAGA
CATACCAAGCAAATAAAACTCTATGCTACCGGCAGTAGAGACCCCAGCACAGAAGTTCATGTGAGAGCCA
TTAAAACTATGACTTCATTTATCTTCTTTTTTTTCCTATACTATATTTCTTCTATTTTGATGACCTTTAG
CTATCTTATGACAAAATACAAGTTAGCTGTGGAGTTTGGAGAGATTGCAGCAATTCTCTACCCCTTGGGT
CACTCACTTATTTTAATTGTTTTAAATAATAAACTGAGGCAGACATTTGTCAGAATGCTGACATGTAGAA
AAATTGCCTGCATGATATGA


Restriction Sites SgfI-MluI     
ACCN NM_023918
ORF Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_023918.1, NP_076407.1
RefSeq Size 930
RefSeq ORF 930
Locus ID 50836
Protein Families Transmembrane
Protein Pathways Taste transduction
Gene Summary This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.