TAS2R14 (NM_023922) Human Untagged Clone
CAT#: SC305084
TAS2R14 (untagged)-Human taste receptor, type 2, member 14 (TAS2R14)
"NM_023922" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TAS2R14 |
Synonyms | T2R14; TRB1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_023922, the custom clone sequence may differ by one or more nucleotides
ATGGGTGGTGTCATAAAGAGCATATTTACATTCGTTTTAATTGTGGAATTTATAATTGGAAATTTAGGAA ATAGTTTCATAGCACTGGTGAACTGTATTGACTGGGTCAAGGGAAGAAAGATCTCTTCGGTTGATCGGAT CCTCACTGCTTTGGCAATCTCTCGAATTAGCCTGGTTTGGTTAATATTCGGAAGCTGGTGTGTGTCTGTG TTTTTCCCAGCTTTATTTGCCACTGAAAAAATGTTCAGAATGCTTACTAATATCTGGACAGTGATCAATC ATTTTAGTGTCTGGTTAGCTACAGGCCTCGGTACTTTTTATTTTCTCAAGATAGCCAATTTTTCTAACTC TATTTTTCTCTACCTAAAGTGGAGGGTTAAAAAGGTGGTTTTGGTGCTGCTTCTTGTGACTTCGGTCTTC TTGTTTTTAAATATTGCACTGATAAACATCCATATAAATGCCAGTATCAATGGATACAGAAGAAACAAGA CTTGCAGTTCTGATTCAAGTAACTTTACACGATTTTCCAGTCTTATTGTATTAACCAGCACTGTGTTCAT TTTCATACCCTTTACTTTGTCCCTGGCAATGTTTCTTCTCCTCATCTTCTCCATGTGGAAACATCGCAAG AAGATGCAGCACACTGTCAAAATATCCGGAGACGCCAGCACCAAAGCCCACAGAGGAGTTAAAAGTGTGA TCACTTTCTTCCTACTCTATGCCATTTTCTCTCTGTCTTTTTTCATATCAGTTTGGACCTCTGAAAGGTT GGAGGAAAATCTAATTATTCTTTCCCAGGTGATGGGAATGGCTTATCCTTCATGTCACTCATGTGTTCTG ATTCTTGGAAACAAGAAGCTGAGACAGGCCTCTCTGTCAGTGCTACTGTGGCTGAGGTACATGTTCAAAG ATGGGGAGCCCTCAGGTCACAAAGAATTTAGAGAATCATCTTGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_023922 |
ORF Size | 954 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_023922.1, NP_076411.1 |
RefSeq Size | 954 |
RefSeq ORF | 954 |
Locus ID | 50840 |
Protein Families | Transmembrane |
Protein Pathways | Taste transduction |
Gene Summary | This gene product belongs to the family of candidate taste receptors that are members of the G-protein-coupled receptor superfamily. These proteins are specifically expressed in the taste receptor cells of the tongue and palate epithelia. They are organized in the genome in clusters and are genetically linked to loci that influence bitter perception in mice and humans. In functional expression studies, they respond to bitter tastants. This gene maps to the taste receptor gene cluster on chromosome 12p13. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224253 | TAS2R14 (Myc-DDK-tagged)-Human taste receptor, type 2, member 14 (TAS2R14) |
USD 420.00 |
|
RG224253 | TAS2R14 (GFP-tagged) - Human taste receptor, type 2, member 14 (TAS2R14) |
USD 460.00 |
|
RC224253L1 | Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), Myc-DDK-tagged |
USD 620.00 |
|
RC224253L2 | Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), mGFP tagged |
USD 620.00 |
|
RC224253L3 | Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), Myc-DDK-tagged |
USD 620.00 |
|
RC224253L4 | Lenti ORF clone of Human taste receptor, type 2, member 14 (TAS2R14), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review