C7orf69 (NM_025031) Human Untagged Clone

CAT#: SC305216

C7orf69 (untagged)-Human chromosome 7 open reading frame 69 (C7orf69)

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: C7orf69
• Synonyms: FLJ21075
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_025031 edited
  GCCACCATGGGTTTCCACTTTTGCATCTGGATCATTTTTCTCTTGCCACCACCATGTAAG
  AAGTGCCTTTCACCTCCCACCATGAACCTGAGGCCTCCCAAGTCATGTGGAAATGTCTTT
  TATTGGGTGCTGGTTCTTAACTCTGGACTTCTCTACAAGTTTTGTCAAACTATCAAATGC
  AGAGCAAATTGGAGGCCTGCCAGAGCACCCAGAGGGTGGAATGAAGCAACAGAGAGGCAT
  CAGGAAAGGAGAACACAGATGGAGACAGAGATGGGAGGCATAAGCACCACCTACTGGCAC
  AGGCTGTGCACTTGCACGGATAGGAGAGCTGAAAAGTTGGTCATGGATGGAAATAACTGC
  TGGTTTCACAAATGA
  
• Restriction Sites: Please inquire
• ACCN: NM_025031
• ORF Size: 369 bp
• Insert Size: 400
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_025031.1, NP_079307.1
• RefSeq Size: 664
• RefSeq ORF: 369
• Locus ID: 80099