KIF25 (NM_030615) Human Untagged Clone

CAT#: SC305269

KIF25 (untagged)-Human kinesin family member 25 (KIF25), transcript variant 1


  "NM_030615" in other vectors (4)

Reconstitution Protocol

USD 660.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KIF25"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KIF25
Synonyms KNSL3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_030615, the custom clone sequence may differ by one or more nucleotides


ATGACATGGACCTCAGGTCAGCTTCAGCGTGAGAAGCAGGCCAGGCCTGGGTCTGGAGCCGTCCTGGCCT
TCCCAGATGACAAGGACCTCAGGGTTTATGGTCCAGCAGAGTCTCAGAGCGCGGTCTTTGGAGATGTGTG
CCCCCTACTCACTTCTCTCTTGGATGGGTACAATGTTTGTGTTATGGCGTATGGACAGACGGGCAGCGGA
AAGAGCTATACCATGCTGGGACGCCATTCGGACGACGGCCCTGTTCTGCCGCTTGACCCACAGAGTGACT
TAGGAATTATCCCTAGAGTGGCTGAGGAGCTCTTCAGGCTCATTTTGGAAAATACCTCAAGAAGCCCAAA
GGTTGAAGTCTCCATAGTGGAAGTTTACAATAATGACATTTTTGACCTTCTGGCCAAAGACAGCATTGCA
GCAGTGTCGGGGGTCAAGCGTGAGGTGGTGACAGCCAAGGATGGACGGACAGAGGTTGCGCTGCTGGCCT
CTGAGGCTGTCGGCAGCGCCTCGAAACTGATGGAGCTCGTTCATGGAGGTCTGCAGCTCAGGGCGAAGCA
CCCCACCCTGGTGCACGCGGATTCCTCCAGGTCTCACCTGATAATTACGGTGACTCTAACCACAGCCTCC
TGCTCTGACAGCACTGCAGACCAAGCCTGCAGTGCCACCCTCCCCAGGGAGCAAACAGAGGCAGGAAGGG
CAGGAAGGAGCCGCAGAGCTTCTCAAGGGGCCTTGGCTCCACAGCTGGTTCCTGGGAACCCCGCAGGGCA
TGCGGAGCAGGTGCAGGCTCGACTACAGCTCGTGGACTCGGCCGGCAGCGAGTGCGTTGGTGTGTCTGGA
GTGACCGGGTTGGCCCTGAGGGAGATGGCGTGCATCAGCCGCAGCCTTGCGGCCCTGGCAGGCGTCCTGG
GGGCTTTGTTGGAGCACCGTGGCCATGCCCCGTACCGGAACAGCAGGCTCACCCACCTCCTTCAGGACTG
CCTCGGAGGCGATGCGAAGTTACTGGTGATTCTCTGCATTTCTCCCAGCCAGAGGCACCTGGCACAGACG
TTGCAGGGCCTGGGTTTCGGGATCCGAGCTCGGCAAGTCCAGCGAGGCCCTGCCCGAAAGAAGCCGCCCA
GCTCCCAAACGGAGGGGAAGAGGAGGCCGGATTGA


Restriction Sites SgfI-MluI     
ACCN NM_030615
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_030615.2, NP_085118.2
RefSeq Size 1510 bp
RefSeq ORF 1155 bp
Locus ID 3834
Cytogenetics 6q27
Protein Families Druggable Genome
Gene Summary 'The protein encoded by this gene is a member of the kinesin-like protein family. Protein family members are microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. However, the particular function of this gene product has not yet been determined. Two alternatively spliced transcript variants which encode products have been described. Other splice variants have been found that lack exon 2 and the initiation codon for translation. [provided by RefSeq, Jul 2008]'
Transcript Variant: This transcript (1) contains exon 8, and encodes the full length isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.