SPACA1 (NM_030960) Human Untagged Clone
CAT#: SC305310
SPACA1 (untagged)-Human sperm acrosome associated 1 (SPACA1)
"NM_030960" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SPACA1 |
Synonyms | SAMP32 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_030960, the custom clone sequence may differ by one or more nucleotides
ATGAGCCCCAGGGGCACGGGCTGCTCCGCCGGGCTGCTGATGACTGTCGGCTGGCTGCTTCTGGCGGGCC TCCAGTCCGCGCGCGGGACCAACGTCACCGCTGCCGTCCAGGATGCCGGCCTGGCCCACGAAGGCGAGGG CGAGGAGGAGACCGAAAACAACGACAGCGAGACCGCGGAGAACTACGCTCCGCCTGAAACCGAGGATGTT TCAAATAGGAATGTCGTCAAAGAAGTAGAATTCGGAATGTGCACCGTTACATGTGGTATTGGTGTTAGAG AAGTTATATTAACAAATGGATGCCCTGGTGGTGAATCCAAGTGTGTTGTACGGGTAGAAGAATGCCGTGG ACCAACAGATTGTGGCTGGGGTAAACCAATTTCAGAAAGTCTTGAAAGTGTTAGATTGGCATGTATTCAC ACATCTCCCTTAAATCGTTTCAAATATATGTGGAAACTTCTAAGACAAGACCAACAATCCATTATACTTG TAAATGATTCAGCAATCCTAGAAGTACGCAAGGAAAGTCACCCCTTGGCTTTCGAGTGTGACACACTGGA TAATAATGAAATAGTAGCAACTATTAAATTCACAGTCTATACGAGCAGTGAATTGCAGATGAGAAGATCA AGCCTACCAGCCACTGATGCAGCCCTAATTTTTGTGCTGACCATAGGAGTCATTATCTGTGTATTTATAA TTTTCTTATTGATCTTCATAATCATAAATTGGGCAGCAGTCAAGGCTTTCTGGGGGGCAAAAGCCTCTAC ACCTGAGGTACAATCCGAGCAGAGTTCTGTGAGATACAAAGATTCAACTTCTCTTGACCAATTACCAACA GAAATGCCTGGTGAAGATGATGCTTTAAGTGAATGGAATGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_030960 |
ORF Size | 885 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_030960.2, NP_112222.1 |
RefSeq Size | 1501 |
RefSeq ORF | 885 |
Locus ID | 81833 |
Protein Families | Transmembrane |
Gene Summary | The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205973 | SPACA1 (Myc-DDK-tagged)-Human sperm acrosome associated 1 (SPACA1) |
USD 420.00 |
|
RG205973 | SPACA1 (GFP-tagged) - Human sperm acrosome associated 1 (SPACA1) |
USD 460.00 |
|
RC205973L3 | Lenti ORF clone of Human sperm acrosome associated 1 (SPACA1), Myc-DDK-tagged |
USD 620.00 |
|
RC205973L4 | Lenti ORF clone of Human sperm acrosome associated 1 (SPACA1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review