SPACA1 (NM_030960) Human Untagged Clone

CAT#: SC305310

SPACA1 (untagged)-Human sperm acrosome associated 1 (SPACA1)


  "NM_030960" in other vectors (4)

Reconstitution Protocol

USD 660.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "SPACA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SPACA1
Synonyms SAMP32
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_030960, the custom clone sequence may differ by one or more nucleotides


ATGAGCCCCAGGGGCACGGGCTGCTCCGCCGGGCTGCTGATGACTGTCGGCTGGCTGCTTCTGGCGGGCC
TCCAGTCCGCGCGCGGGACCAACGTCACCGCTGCCGTCCAGGATGCCGGCCTGGCCCACGAAGGCGAGGG
CGAGGAGGAGACCGAAAACAACGACAGCGAGACCGCGGAGAACTACGCTCCGCCTGAAACCGAGGATGTT
TCAAATAGGAATGTCGTCAAAGAAGTAGAATTCGGAATGTGCACCGTTACATGTGGTATTGGTGTTAGAG
AAGTTATATTAACAAATGGATGCCCTGGTGGTGAATCCAAGTGTGTTGTACGGGTAGAAGAATGCCGTGG
ACCAACAGATTGTGGCTGGGGTAAACCAATTTCAGAAAGTCTTGAAAGTGTTAGATTGGCATGTATTCAC
ACATCTCCCTTAAATCGTTTCAAATATATGTGGAAACTTCTAAGACAAGACCAACAATCCATTATACTTG
TAAATGATTCAGCAATCCTAGAAGTACGCAAGGAAAGTCACCCCTTGGCTTTCGAGTGTGACACACTGGA
TAATAATGAAATAGTAGCAACTATTAAATTCACAGTCTATACGAGCAGTGAATTGCAGATGAGAAGATCA
AGCCTACCAGCCACTGATGCAGCCCTAATTTTTGTGCTGACCATAGGAGTCATTATCTGTGTATTTATAA
TTTTCTTATTGATCTTCATAATCATAAATTGGGCAGCAGTCAAGGCTTTCTGGGGGGCAAAAGCCTCTAC
ACCTGAGGTACAATCCGAGCAGAGTTCTGTGAGATACAAAGATTCAACTTCTCTTGACCAATTACCAACA
GAAATGCCTGGTGAAGATGATGCTTTAAGTGAATGGAATGAATGA


Restriction Sites SgfI-MluI     
ACCN NM_030960
ORF Size 885 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_030960.2, NP_112222.1
RefSeq Size 1501
RefSeq ORF 885
Locus ID 81833
Protein Families Transmembrane
Gene Summary The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.