KRTAP3-1 (NM_031958) Human Untagged Clone
CAT#: SC305378
KRTAP3 (untagged)-Human keratin associated protein 3-1 (KRTAP3-1)
"NM_031958" in other vectors (4)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KRTAP3-1 |
Synonyms | KAP3.1; KRTAP3.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_031958, the custom clone sequence may differ by one or more nucleotides
ATGTATTGCTGTGCTCTCCGCTCCTGCAGCGTCCCCACCGGCCCTGCCACCACCTTCTGCTCATTTGATA AAAGCTGCCGCTGTGGAGTCTGCCTACCCAGCACCTGCCCACATGAGATCAGCCTCCTTCAGCCCATCTG CTGTGACACCTGCCCCCCACCCTGCTGCAAGCCTGATACCTATGTGCCAACTTGCTGGCTGCTCAACAAC TGTCACCCGACTCCCGGACTGAGTGGGATCAACCTGACCACCTATGTTCAGCCTGGCTGTGAGAGTCCCT GTGAGCCCCGCTGTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_031958 |
ORF Size | 297 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_031958.1, NP_114164.1 |
RefSeq Size | 614 |
RefSeq ORF | 297 |
Locus ID | 83896 |
Gene Summary | This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211851 | KRTAP3 (Myc-DDK-tagged)-Human keratin associated protein 3-1 (KRTAP3-1) |
USD 98.00 |
|
RG211851 | KRTAP3 (GFP-tagged) - Human keratin associated protein 3-1 (KRTAP3-1) |
USD 460.00 |
|
RC211851L3 | Lenti ORF clone of Human keratin associated protein 3-1 (KRTAP3-1), Myc-DDK-tagged |
USD 620.00 |
|
RC211851L4 | Lenti ORF clone of Human keratin associated protein 3-1 (KRTAP3-1), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review