KRTAP3-1 (NM_031958) Human Untagged Clone

CAT#: SC305378

KRTAP3 (untagged)-Human keratin associated protein 3-1 (KRTAP3-1)


  "NM_031958" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "KRTAP3-1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol KRTAP3-1
Synonyms KAP3.1; KRTAP3.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_031958, the custom clone sequence may differ by one or more nucleotides


ATGTATTGCTGTGCTCTCCGCTCCTGCAGCGTCCCCACCGGCCCTGCCACCACCTTCTGCTCATTTGATA
AAAGCTGCCGCTGTGGAGTCTGCCTACCCAGCACCTGCCCACATGAGATCAGCCTCCTTCAGCCCATCTG
CTGTGACACCTGCCCCCCACCCTGCTGCAAGCCTGATACCTATGTGCCAACTTGCTGGCTGCTCAACAAC
TGTCACCCGACTCCCGGACTGAGTGGGATCAACCTGACCACCTATGTTCAGCCTGGCTGTGAGAGTCCCT
GTGAGCCCCGCTGTTAA


Restriction Sites SgfI-MluI     
ACCN NM_031958
ORF Size 297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_031958.1, NP_114164.1
RefSeq Size 614
RefSeq ORF 297
Locus ID 83896
Gene Summary This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.