IL1F10 (NM_032556) Human Untagged Clone

CAT#: SC305472

IL1F10 (untagged)-Human interleukin 1 family, member 10 (theta) (IL1F10), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL1F10
• Synonyms: FIL1-theta; FKSG75; IL-1HY2; IL-38; IL1-theta; IL1HY2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_032556, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGTTCCCTCCCCATGGCAAGATACTACATAATTAAATATGCAGACCAGAAGGCTCTATACACAAGAG
  ATGGCCAGCTGCTGGTGGGAGATCCTGTTGCAGACAACTGCTGTGCAGAGAAGATCTGCATACTTCCTAA
  CAGAGGCTTGGCCCGCACCAAGGTCCCCATTTTCCTGGGGATCCAGGGAGGGAGCCGCTGCCTGGCATGT
  GTGGAGACAGAAGAGGGGCCTTCCCTACAGCTGGAGGATGTGAACATTGAGGAACTGTACAAAGGTGGTG
  AAGAGGCCACACGCTTCACCTTCTTCCAGAGCAGCTCAGGCTCCGCCTTCAGGCTTGAGGCTGCTGCCTG
  GCCTGGCTGGTTCCTGTGTGGCCCGGCAGAGCCCCAGCAGCCAGTACAGCTCACCAAGGAGAGTGAGCCC
  TCAGCCCGTACCAAGTTTTACTTTGAACAGAGCTGGTAG
  
  
• Restriction Sites: Please inquire
• ACCN: NM_032556
• ORF Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.

Reference Data

• RefSeq: NM_032556.4, NP_115945.4
• RefSeq Size: 1376
• RefSeq ORF: 459
• Locus ID: 84639
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. This cytokine is thought to participate in a network of interleukin 1 family members to regulate adapted and innate immune responses. Two alternatively spliced transcript variants encoding the same protein have been reported. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (1) represents the longer transcript. It differs in the 5' UTR compared to variant 2. Both variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.