IDI2 (NM_033261) Human Untagged Clone
CAT#: SC305604
IDI2 (untagged)-Human isopentenyl-diphosphate delta isomerase 2 (IDI2)
"NM_033261" in other vectors (4)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | IDI2 |
Synonyms | IPPI2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_033261, the custom clone sequence may differ by one or more nucleotides
ATGTCTGACATAAATCTTGACTGGGTTGACAGGCGTCAGTTGCAGCGCTTGGAGGAAATGCTGATTGTTG TGGATGAGAATGATAAGGTTATTGGTGCCGACACCAAGAGGAATTGCCATCTGAACGAAAACATTGAGAA AGGGCTGCTGCACCGAGCCTTCAGCGTTGTCTTGTTTAACACCAAGAATCGAATCCTGATACAGCAGAGG TCGGACACGAAAGTCACGTTTCCTGGGTATTTTACCGACTCCTGTAGTAGCCACCCATTATACAACCCAG CAGAACTGGAAGAAAAGGATGCCATCGGAGTGAGGAGGGCAGCCCAGAGGCGTCTGCAAGCAGAGCTGGG AATTCCTGGGGAGCAGATTTCTCCAGAGGACATTGTGTTCATGACAATCTATCACCACAAGGCAAAATCA GACAGAATTTGGGGAGAGCATGAAATTTGTTACCTTCTGCTTGTGAGGAAAAACGTCACTCTGAACCCGG ATCCCAGTGAAACGAAAAGCATCCTCTACCTGTCCCAGGAGGAGCTGTGGGAGCTGCTGGAGAGGGAGGC GAGGGGTGAAGTCAAAGTCACCCCCTGGCTAAGAACCATTGCCGAGAGGTTTCTGTACCGGTGGTGGCCT CACCTGGATGACGTGACCCCGTTTGTGGAGCTTCACAAAATACACAGAGTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_033261 |
ORF Size | 684 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Reference Data | |
RefSeq | NM_033261.2, NP_150286.1 |
RefSeq Size | 1359 |
RefSeq ORF | 684 |
Locus ID | 91734 |
Protein Pathways | Metabolic pathways, Terpenoid backbone biosynthesis |
Gene Summary | The protein encoded by this gene catalyzes the conversion of isopentenyl diphosphate to dimethylallyl diphosphate, which is a precursor for the synthesis of cholesterol and other isoprenoids. This gene, which is a product of an ancestral gene duplication event, encodes a protein that may be involved in the aggregation of alpha-synuclein in the cerebral cortex of patients with Lewy body disease. In addition, segmental copy number gains in this locus have been associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2016] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204632 | IDI2 (Myc-DDK-tagged)-Human isopentenyl-diphosphate delta isomerase 2 (IDI2) |
USD 98.00 |
|
RG204632 | IDI2 (GFP-tagged) - Human isopentenyl-diphosphate delta isomerase 2 (IDI2) |
USD 460.00 |
|
RC204632L3 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 2 (IDI2), Myc-DDK-tagged |
USD 620.00 |
|
RC204632L4 | Lenti ORF clone of Human isopentenyl-diphosphate delta isomerase 2 (IDI2), mGFP tagged |
USD 620.00 |
{0} Product Review(s)
Be the first one to submit a review