IDI2 (NM_033261) Human Untagged Clone

CAT#: SC305604

IDI2 (untagged)-Human isopentenyl-diphosphate delta isomerase 2 (IDI2)


  "NM_033261" in other vectors (4)

Reconstitution Protocol

USD 420.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "IDI2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol IDI2
Synonyms IPPI2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033261, the custom clone sequence may differ by one or more nucleotides


ATGTCTGACATAAATCTTGACTGGGTTGACAGGCGTCAGTTGCAGCGCTTGGAGGAAATGCTGATTGTTG
TGGATGAGAATGATAAGGTTATTGGTGCCGACACCAAGAGGAATTGCCATCTGAACGAAAACATTGAGAA
AGGGCTGCTGCACCGAGCCTTCAGCGTTGTCTTGTTTAACACCAAGAATCGAATCCTGATACAGCAGAGG
TCGGACACGAAAGTCACGTTTCCTGGGTATTTTACCGACTCCTGTAGTAGCCACCCATTATACAACCCAG
CAGAACTGGAAGAAAAGGATGCCATCGGAGTGAGGAGGGCAGCCCAGAGGCGTCTGCAAGCAGAGCTGGG
AATTCCTGGGGAGCAGATTTCTCCAGAGGACATTGTGTTCATGACAATCTATCACCACAAGGCAAAATCA
GACAGAATTTGGGGAGAGCATGAAATTTGTTACCTTCTGCTTGTGAGGAAAAACGTCACTCTGAACCCGG
ATCCCAGTGAAACGAAAAGCATCCTCTACCTGTCCCAGGAGGAGCTGTGGGAGCTGCTGGAGAGGGAGGC
GAGGGGTGAAGTCAAAGTCACCCCCTGGCTAAGAACCATTGCCGAGAGGTTTCTGTACCGGTGGTGGCCT
CACCTGGATGACGTGACCCCGTTTGTGGAGCTTCACAAAATACACAGAGTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_033261
ORF Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Reference Data
RefSeq NM_033261.2, NP_150286.1
RefSeq Size 1359
RefSeq ORF 684
Locus ID 91734
Protein Pathways Metabolic pathways, Terpenoid backbone biosynthesis
Gene Summary The protein encoded by this gene catalyzes the conversion of isopentenyl diphosphate to dimethylallyl diphosphate, which is a precursor for the synthesis of cholesterol and other isoprenoids. This gene, which is a product of an ancestral gene duplication event, encodes a protein that may be involved in the aggregation of alpha-synuclein in the cerebral cortex of patients with Lewy body disease. In addition, segmental copy number gains in this locus have been associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2016]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.